View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9606_low_15 (Length: 260)
Name: NF9606_low_15
Description: NF9606
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9606_low_15 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 72; Significance: 8e-33; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 72; E-Value: 8e-33
Query Start/End: Original strand, 165 - 240
Target Start/End: Original strand, 14980508 - 14980583
Alignment:
| Q |
165 |
tgtacaagttctatctaaggtcttatctaacaaattgaggaaagtaattggtgaaagatatttctatcctttactt |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
14980508 |
tgtacaagttctatctaaggtcttatctaacaaattgaggaaagtaattggtgaaagatatttctatccttcactt |
14980583 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 104 - 168
Target Start/End: Original strand, 14979910 - 14979974
Alignment:
| Q |
104 |
atctctactcttgacactcgggaagaggatttcgatcttatggctaaagaattaaaggatctgta |
168 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||| |||| |
|
|
| T |
14979910 |
atctctactcttgacactcggggagaggatttcgatcttatggctaaagagttaaaggatttgta |
14979974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University