View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9606_low_22 (Length: 222)
Name: NF9606_low_22
Description: NF9606
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9606_low_22 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 15 - 204
Target Start/End: Complemental strand, 3732656 - 3732467
Alignment:
| Q |
15 |
tggtgttaagggattgaggaccaaatcaattcatcctcctattgaaatgcattgggatctccctactacacaaaaaggaaagaaaaaggcttcactctcc |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3732656 |
tggtgttaagggattgaggaccaaatcaattcatcctcctattgaaatgcattgggatctccctactacacaaaaaggaaagaaaaaggcttcactctcc |
3732557 |
T |
 |
| Q |
115 |
atcaagtcattgttgtcttacccactcatgaaatttggaaggagtaaaagtttggaaatggttctagaaggaactcatgatccaaatgat |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3732556 |
atcaagtcattgttgtcttacccactcatgaaatttggaaggagtaaaagtttggaaatggttctagaaggaactcatgatccaaatgat |
3732467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University