View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9607_5 (Length: 322)
Name: NF9607_5
Description: NF9607
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9607_5 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 86; Significance: 4e-41; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 86; E-Value: 4e-41
Query Start/End: Original strand, 201 - 298
Target Start/End: Complemental strand, 22080160 - 22080064
Alignment:
| Q |
201 |
caactgaaaaacattatgtattttagatggttattttttaaactatatccaacaatgttcttttagttccaacatttcttgatgtagtcttagtgatg |
298 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
22080160 |
caactgaaaaacattatgtattttagatggttattttttaaactatatccaac-atgttcttttagttccaacattttttgatgtagtcttagtgatg |
22080064 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 51 - 125
Target Start/End: Complemental strand, 22080416 - 22080342
Alignment:
| Q |
51 |
aaataaattaccatgtacaggtttggttgtttctgatgagtttttgttcttcccatgtttagaatttatagtttg |
125 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
22080416 |
aaataaattaccatgtacaggtttggttgtttctgaggagtttttgttcttcacatgtttagaatttatagtttg |
22080342 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University