View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9609_high_11 (Length: 248)
Name: NF9609_high_11
Description: NF9609
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9609_high_11 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 19 - 248
Target Start/End: Complemental strand, 14177391 - 14177162
Alignment:
| Q |
19 |
cacagacattgactatgttcttcgatatcgatacacctagtttgttatctggatccacatcctggtatacacatgcataagattgatcatcatatgcatt |
118 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14177391 |
cacaaacattgactatgttcttcgatatcgatacacctagtttgttatctggatccacatcctggtatacacatgcataagattgatcatcatatgcatt |
14177292 |
T |
 |
| Q |
119 |
gattgttctagcaatatgttttagctcatactttgccttatacttatcttgaaccctgcttgacatcagtatagctgatcctcccattctgaatagacaa |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14177291 |
gattgttctagcaatatgttttagctcatactttgccttatgcttatcttgaaccctgcttgacatcagtatagctgatcctcccattctgaatagacaa |
14177192 |
T |
 |
| Q |
219 |
ttagttagtagcatagatggaactttacct |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
14177191 |
ttagttagtagcatagatggaactttacct |
14177162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University