View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9609_low_17 (Length: 350)
Name: NF9609_low_17
Description: NF9609
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9609_low_17 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 291; Significance: 1e-163; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 291; E-Value: 1e-163
Query Start/End: Original strand, 1 - 335
Target Start/End: Original strand, 25683086 - 25683423
Alignment:
| Q |
1 |
gtgtgaagcatcttctttgcatgcatggatcgtgcatgactcatctcaacaaaggcatggaaaaggaaaaattgcttttcattttctatcaatcacgagg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25683086 |
gtgtgaagcatcttctttgcatgcatggatcgtgcatgactcatctcaacaaaggcatggaaaaggaaaaattgcttttcattttctatcaatcacgagg |
25683185 |
T |
|
| Q |
101 |
ttcttgataatagtaggttctaactccagcatatatatgtcaactttatcatcgtgcatggtggcattggagtctctccattaattctcattcctaacta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25683186 |
ttcttgataatagtaggttctaactccagcatatatatgtcaactttatcatcgtgcatggtggcattggagtctctccattaattctcattcctaacta |
25683285 |
T |
|
| Q |
201 |
ctcaaaattggaggaattttgttttaaacatcaaataagaattttaataaagaaacggagccaagtacaagggt---tagaccatcaaagagatcnnnnn |
297 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| || || |
|
|
| T |
25683286 |
ctcaaaattggaggaattttgttttaaacatcaaataagaattttaataaagaaacggagccaagtacaagggttactagaccatcaaatagttcaaaaa |
25683385 |
T |
|
| Q |
298 |
nntacaaatagtactaaacctgcccaagaaaccaagaa |
335 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| |
|
|
| T |
25683386 |
aatacaaatagtacaaaacctgcccaagaaaccaagaa |
25683423 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University