View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9610_high_3 (Length: 304)
Name: NF9610_high_3
Description: NF9610
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9610_high_3 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 88; Significance: 3e-42; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 88; E-Value: 3e-42
Query Start/End: Original strand, 1 - 132
Target Start/End: Complemental strand, 12157944 - 12157813
Alignment:
| Q |
1 |
tatggttccaagctcacaaatatcttttcacttgaatttattactgaggcagtcgagggaactacaaagtttagacaggtatgtcgatattttgatcgta |
100 |
Q |
| |
|
|||||||||| ||||| ||||||||||||||||||||||||||| ||||||||| ||| ||||||||||||| ||| ||||| ||||||||||||||| |
|
|
| T |
12157944 |
tatggttccaggctcataaatatcttttcacttgaatttattacagaggcagtcaaggatactacaaagtttaaacatgtatgatgatattttgatcgta |
12157845 |
T |
 |
| Q |
101 |
ttagatttttgttttcacacgtatattgatat |
132 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| |
|
|
| T |
12157844 |
ttagatttttgttttcacacgtctattgatat |
12157813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 203 - 241
Target Start/End: Original strand, 32373647 - 32373685
Alignment:
| Q |
203 |
aaacaacacattttcaccaagtgctttgaactctctctc |
241 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
32373647 |
aaacagcacattttcaccaagtgctttgaactctctctc |
32373685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University