View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9610_low_5 (Length: 304)

Name: NF9610_low_5
Description: NF9610
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9610_low_5
NF9610_low_5
[»] chr2 (1 HSPs)
chr2 (1-132)||(12157813-12157944)
[»] chr4 (1 HSPs)
chr4 (203-241)||(32373647-32373685)


Alignment Details
Target: chr2 (Bit Score: 88; Significance: 3e-42; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 88; E-Value: 3e-42
Query Start/End: Original strand, 1 - 132
Target Start/End: Complemental strand, 12157944 - 12157813
Alignment:
1 tatggttccaagctcacaaatatcttttcacttgaatttattactgaggcagtcgagggaactacaaagtttagacaggtatgtcgatattttgatcgta 100  Q
    |||||||||| ||||| ||||||||||||||||||||||||||| ||||||||| |||  ||||||||||||| ||| |||||  |||||||||||||||    
12157944 tatggttccaggctcataaatatcttttcacttgaatttattacagaggcagtcaaggatactacaaagtttaaacatgtatgatgatattttgatcgta 12157845  T
101 ttagatttttgttttcacacgtatattgatat 132  Q
    |||||||||||||||||||||| |||||||||    
12157844 ttagatttttgttttcacacgtctattgatat 12157813  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 203 - 241
Target Start/End: Original strand, 32373647 - 32373685
Alignment:
203 aaacaacacattttcaccaagtgctttgaactctctctc 241  Q
    ||||| |||||||||||||||||||||||||||||||||    
32373647 aaacagcacattttcaccaagtgctttgaactctctctc 32373685  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University