View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9610_low_8 (Length: 278)
Name: NF9610_low_8
Description: NF9610
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9610_low_8 |
 |  |
|
| [»] scaffold0008 (3 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0008 (Bit Score: 59; Significance: 5e-25; HSPs: 3)
Name: scaffold0008
Description:
Target: scaffold0008; HSP #1
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 22 - 92
Target Start/End: Original strand, 65158 - 65228
Alignment:
| Q |
22 |
gaaattaatatggttaataactaactatgatctgacttagcaaagaagatagaaaacaggatatttcatcc |
92 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||| |||| |
|
|
| T |
65158 |
gaaattaatatggttaataaccaactatgatctgacttagcaaagaagatagaaaacaagatatttgatcc |
65228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0008; HSP #2
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 172 - 262
Target Start/End: Original strand, 65308 - 65399
Alignment:
| Q |
172 |
tgcaaagaaacaatgtacaatgta--ccctacttgtgagtgatatatattgcgacagaacaaacctttgagatgaacaaaacagataattttg |
262 |
Q |
| |
|
|||| |||||||||||||||| || || ||||||| |||||||||||||| |||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
65308 |
tgcagagaaacaatgtacaatatataccttacttgtaagtgatatatattgtgacagaacaaacctttgagatgaacaaaac-gataattttg |
65399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0008; HSP #3
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 177 - 262
Target Start/End: Original strand, 73156 - 73242
Alignment:
| Q |
177 |
agaaacaatgtacaatgta--ccctacttgtgagtgatatatattgcgacagaacaaacctttgagatgaacaaaacagataattttg |
262 |
Q |
| |
|
|||||||||||||||| || || ||||||| |||||||||||||| |||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
73156 |
agaaacaatgtacaatatataccttacttgtaagtgatatatattgtgacagaacaaacctttgagatgaacaaaac-gataattttg |
73242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University