View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9611_low_1 (Length: 361)
Name: NF9611_low_1
Description: NF9611
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9611_low_1 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 263; Significance: 1e-146; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 263; E-Value: 1e-146
Query Start/End: Original strand, 67 - 345
Target Start/End: Original strand, 52463652 - 52463930
Alignment:
| Q |
67 |
aaagttggtattcttttcataatctgtttcacagaaaacagtgcaggaagtttaagattggacaaagaagtaaaagaatacaaggtctctatcttcattg |
166 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52463652 |
aaagttggtattcttttcataatctgtttcacagaaaacagtacaggaagtttaagattggacaaagaagtaaaagaatacaaggtctctatcttcattg |
52463751 |
T |
|
| Q |
167 |
ttcatatatactgtagtttgcttgacacagctgttcttgaaataaattgtttagaattttgttttaacgtaaggccgtattaagttcagtgtaaaatatc |
266 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
52463752 |
ttcatatatactgtagtttgcttgacacagctgttcttgaaataaattgtttagaattttgttttaacgtaaggctgtattaagttcagtgtaaaatatc |
52463851 |
T |
|
| Q |
267 |
ttgtatgtttgatggagttttgcaaaaacagtgaagtctaggttgaccttaaatattatggtcttcaacctgactaaag |
345 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
52463852 |
ttgtatgtttgatggagttttgcaagaacagtgaagtctaggttgaccttaaatattatggtcttcaacctgaccaaag |
52463930 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 10 - 42
Target Start/End: Original strand, 52463592 - 52463624
Alignment:
| Q |
10 |
gtgttcatagtcactcatatatgtgaatgaggg |
42 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
52463592 |
gtgttcatagtcactcatatatgtgaatgaggg |
52463624 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 46; Significance: 4e-17; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 67 - 120
Target Start/End: Original strand, 22704193 - 22704246
Alignment:
| Q |
67 |
aaagttggtattcttttcataatctgtttcacagaaaacagtgcaggaagttta |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||| ||||||||||| |
|
|
| T |
22704193 |
aaagttggtattcttttcataatctgtttcacaaaaaacagtacaggaagttta |
22704246 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University