View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9611_low_10 (Length: 204)
Name: NF9611_low_10
Description: NF9611
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9611_low_10 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 183; Significance: 3e-99; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 183; E-Value: 3e-99
Query Start/End: Original strand, 6 - 196
Target Start/End: Complemental strand, 42526293 - 42526103
Alignment:
| Q |
6 |
gtggagaagcacagaggaattgctcttattggacgaataaattcaagatccgagttggctgaagcttggcgttgaacatgtaaaggtgtatgttttttct |
105 |
Q |
| |
|
||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42526293 |
gtggagaagaacaggggaattgctcttattggacgaataaattcaagatccgagttggctgaagcttggcgttgaacatgtaaaggtgtatgttttttct |
42526194 |
T |
|
| Q |
106 |
atcttgctgtctgggggaatgggatggatgacaagaaaaatggtactcaaataatctttgcgcatatgcgagttgcatgattgctgatgtc |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42526193 |
atcttgctgtctgggggaatgggatggatgacaagaaaaatggtactcaaataatctttgcgcatatgcgagttgcatgattgctgatgtc |
42526103 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University