View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9611_low_11 (Length: 202)
Name: NF9611_low_11
Description: NF9611
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9611_low_11 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 139; Significance: 6e-73; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 139; E-Value: 6e-73
Query Start/End: Original strand, 16 - 184
Target Start/End: Complemental strand, 23165295 - 23165125
Alignment:
| Q |
16 |
agatatcaactatcttgagggtgatacaggtcagacaagcctgtcgggacacactagagcagttttaattactc-ttttagaacggccggtagagatcat |
114 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
23165295 |
agatatcaaccatcttgagggtgatacaggtcagacaagcctgtcgggacacactagagcagttttaattactctttttagaacggccggtagagatcat |
23165196 |
T |
|
| Q |
115 |
taagtacttggtcaaatgtgtaata-ctaccatcagtaattattactcaaatctgattagtccataaccac |
184 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
23165195 |
taagtacttggtcaaatgtgtaatatttaccatcagtaattattactcaaatctgataggtccataaccac |
23165125 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University