View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9612A_high_44 (Length: 252)
Name: NF9612A_high_44
Description: NF9612A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9612A_high_44 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 124; Significance: 7e-64; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 124; E-Value: 7e-64
Query Start/End: Original strand, 6 - 200
Target Start/End: Complemental strand, 10155769 - 10155574
Alignment:
| Q |
6 |
gtagattattctgatatgtttaaaggccttttaggtagtttgtaatccgagtgatattagctaaatatgnnnnnnnn-gctaataagctaaatatgtttt |
104 |
Q |
| |
|
|||||||| ||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
10155769 |
gtagattagtctgatatgtttaaaggttttttaggtagtctgtaatccgagtgatattagctaaatatgtttttttttgctaataagctaaatatgtttt |
10155670 |
T |
 |
| Q |
105 |
taaaaatgcattggtcttgtttatttaataaaatagcatgaccagacattaatatgacatagactatgttacaggtctataactctataactctat |
200 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||| ||||| ||||| ||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
10155669 |
taaaaatgcattggtctagtttatttaataaaatagtctgacctgacatgaatatgacatagactatgttataggtctataactctataactctat |
10155574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University