View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9612A_high_45 (Length: 251)
Name: NF9612A_high_45
Description: NF9612A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9612A_high_45 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 149; Significance: 8e-79; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 149; E-Value: 8e-79
Query Start/End: Original strand, 47 - 244
Target Start/End: Complemental strand, 25700802 - 25700605
Alignment:
| Q |
47 |
ggcgacgactaggtagtctaaagaagcagtggcagatgacaatcgcaagaggaccgnnnnnnngattgacacatttgtgtgagagaagagttgaggaagg |
146 |
Q |
| |
|
|||||| |||||||||||||||||||| ||||||||||||| ||||| |||||||| ||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
25700802 |
ggcgaccactaggtagtctaaagaagcggtggcagatgacagtcgcaggaggaccgaaaaaaagattgacgcatttgtgtgagagaagagttgaggaagg |
25700703 |
T |
 |
| Q |
147 |
aatatgatacaaccaggtctagaatagactcattctccaactgtgggtgacatgtattacttttccagatagaggtgccttcttattcatattcttcg |
244 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||| |
|
|
| T |
25700702 |
aatatgatacaaccaggtctagaatagactcattctccaactgtgggtgacatgtattactttcccagatagaggtgccttcttattcatattattcg |
25700605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 1 - 64
Target Start/End: Complemental strand, 25700885 - 25700822
Alignment:
| Q |
1 |
atcatcgataaaacaagggatgtaattggaagaagtggtgtagagtggcgacgactaggtagtc |
64 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
25700885 |
atcatcgataaaacaagggatgtaattggaagaagtggtgtagagcggcgacgactaggtagtc |
25700822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University