View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9612A_low_105 (Length: 274)
Name: NF9612A_low_105
Description: NF9612A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9612A_low_105 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 1 - 254
Target Start/End: Complemental strand, 10155509 - 10155259
Alignment:
| Q |
1 |
tttcattttctattctttttctccacttcaactttaatttttgttggacttggaacactatcacattattttcacttaaatagaaaatagtgaatatttt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
10155509 |
tttcattttctattctttttctccacttcaactttaatttttgttggacttggaacactatcaaattattttcacttaaatagaaaatagtgaatatttt |
10155410 |
T |
 |
| Q |
101 |
tattgttttcattgtatcaaagtgatacttttactagtaaaataaaattgnnnnnnnnnncttgcaaaaaatgctagtatttctgaaacaagacatgcca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
10155409 |
tattgttttcattgtatcaaagtgatacttttactagtaaaataaaattgttttttttttcttgcaaaaaatgc---tatttctgaaacaagacatgcca |
10155313 |
T |
 |
| Q |
201 |
taagcaatcattttattgaaggaaaaaagttttgagaagcatggagttgtttat |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10155312 |
taagcaatcattttattgaaggaaaaaagttttgagaagcatggagttgtttat |
10155259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University