View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9612A_low_107 (Length: 271)
Name: NF9612A_low_107
Description: NF9612A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9612A_low_107 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 148; Significance: 4e-78; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 148; E-Value: 4e-78
Query Start/End: Original strand, 7 - 170
Target Start/End: Original strand, 21131375 - 21131538
Alignment:
| Q |
7 |
aaaaaccattgacaaattgaggcataccgcagatatatgttgccaggagatggaagatattccatgcatatcattcccttgcaaaccacaagggtccatg |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
21131375 |
aaaaaccattgacaaattgaggcataccgcagatatatgttgccaagagatggaagacattccatgcatttcattcccttgcaaaccacaagggtccatg |
21131474 |
T |
|
| Q |
107 |
gctatgatggtgagtgagaaactcagagtcagaatttgatggagaacattaaaagcaaaaactc |
170 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
21131475 |
gctatgatggtgagtgagaaactcagagtcagaattttatggagaacattaaaagcaaaaactc |
21131538 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 200 - 259
Target Start/End: Complemental strand, 10821937 - 10821878
Alignment:
| Q |
200 |
ttgcagtgtgctgagtctgcattgaaatcagtcataggagatctctccaatacctatttt |
259 |
Q |
| |
|
||||||||||| || ||||| |||||||||||| |||||||||| || ||||| |||||| |
|
|
| T |
10821937 |
ttgcagtgtgcagaatctgccttgaaatcagtcttaggagatctttcgaatacatatttt |
10821878 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 59; Significance: 5e-25; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 196 - 254
Target Start/End: Original strand, 48569143 - 48569201
Alignment:
| Q |
196 |
aatcttgcagtgtgctgagtctgcattgaaatcagtcataggagatctctccaatacct |
254 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48569143 |
aatcttgcagtgtgctgagtctgcattgaaatcagtcataggagatctctccaatacct |
48569201 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University