View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9612A_low_112 (Length: 266)
Name: NF9612A_low_112
Description: NF9612A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9612A_low_112 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 106; Significance: 4e-53; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 106; E-Value: 4e-53
Query Start/End: Original strand, 142 - 251
Target Start/End: Complemental strand, 3640086 - 3639977
Alignment:
| Q |
142 |
tatatagacaaacacctcccttcttctttaatataacttgtttcttggttaaaacacaattactgcactaaaaaattgcaacagtcgttgcaacaaaata |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3640086 |
tatatagacaaacacctcccttcttctttaatataacttgtttcttggttaaaatacaattactgcactaaaaaattgcaacagtcgttgcaacaaaata |
3639987 |
T |
|
| Q |
242 |
ctcacaatat |
251 |
Q |
| |
|
|||||||||| |
|
|
| T |
3639986 |
ctcacaatat |
3639977 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 97; E-Value: 9e-48
Query Start/End: Original strand, 1 - 152
Target Start/End: Complemental strand, 3640406 - 3640257
Alignment:
| Q |
1 |
aaataaagctaaaaatataatattgttgacaattctatgttgtatgtaccaagtaagaaaaagtgtagttacnnnnnnnnnnnnnntctcccaaaaatac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
3640406 |
aaataaagctaaaaatataatattgttgacaattctatgttgtatgtaccaagtaagaaaaagtgtagttac--aaaaaaaaaaaatctcccaaaaatac |
3640309 |
T |
|
| Q |
101 |
tccggtcttaaaatatacattgatctcccctaaatcctcattatatagacaa |
152 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
3640308 |
tctggtcttaaaatatacattgatctcccctaaatcctcatcatatagacaa |
3640257 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University