View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9612A_low_115 (Length: 262)
Name: NF9612A_low_115
Description: NF9612A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9612A_low_115 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 113; Significance: 3e-57; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 113; E-Value: 3e-57
Query Start/End: Original strand, 85 - 221
Target Start/End: Complemental strand, 15827348 - 15827214
Alignment:
| Q |
85 |
cttgactcatatgctttaacaatttcatgaagaaatcacaatagtctagcttgtctatcagcagaagtattgaggcatatcaagtgtcaagtaaaaaggt |
184 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
15827348 |
cttgactcatatgctt-aacaatttcatgaagaaatcacaagagtctagcttgtctatcagcagaagtattgaggcatatcaggtgtcaagtaaaaaggt |
15827250 |
T |
|
| Q |
185 |
atagtcttatctcaaatgcaatcatagatcacctaaa |
221 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
15827249 |
atagtcttatctc-aatgcaatcatagatcacctaaa |
15827214 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 1 - 92
Target Start/End: Complemental strand, 15827586 - 15827495
Alignment:
| Q |
1 |
aatgttggttatatcataagaaattccacttgcgagtcatatcccaatgttcaaaatgaaattttttatgagagaaaccatacacttgactc |
92 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15827586 |
aatgttggttatatcatgagaaattccacttgcgagtcatatcccaatgttcaaaatgaaattttttatgagagaaaccatacacttgactc |
15827495 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 173 - 230
Target Start/End: Original strand, 5600618 - 5600674
Alignment:
| Q |
173 |
aagtaaaaaggtatagtcttatctcaaatgcaatcatagatcacctaaaaagagaaga |
230 |
Q |
| |
|
||||||||| || ||||| ||||||| || ||||||||||||||||||||||||||| |
|
|
| T |
5600618 |
aagtaaaaacatagagtctcatctcaa-tgtaatcatagatcacctaaaaagagaaga |
5600674 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University