View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9612A_low_123 (Length: 259)
Name: NF9612A_low_123
Description: NF9612A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9612A_low_123 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 102 - 259
Target Start/End: Original strand, 40758314 - 40758471
Alignment:
| Q |
102 |
taagcattgtgatattattgatgttgaaagaactgttatgctgatgttatttataccgaaagaataatgtatacacaaggaatctattttcaatagattt |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40758314 |
taagcattgtgatattattgatgttgaaagaattgttatgctgatgttatttatactgaaagaataatgtatacacaaggaatctattttcaatagattt |
40758413 |
T |
|
| Q |
202 |
aacattaaaatattacaatggaaaatccagtcaaattttgtgcaagaccgcagtagta |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40758414 |
aacattaaaatattacaatggaaaatccagtcaaattttgtgcaagaccgcagtagta |
40758471 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University