View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9612A_low_125 (Length: 258)
Name: NF9612A_low_125
Description: NF9612A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9612A_low_125 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 102; Significance: 9e-51; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 102; E-Value: 9e-51
Query Start/End: Original strand, 5 - 110
Target Start/End: Original strand, 20232527 - 20232632
Alignment:
| Q |
5 |
caatgacaaacataaaatatattttgaattcaaacattgagcccttcaattatctctatctcacaagatgattaaaacatactctaaatgagctaggaat |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20232527 |
caatgacaaacataaaatatattttgaattcaaacattgagcccttcatttatctctatctcacaagatgattaaaacatactctaaatgagctaggaat |
20232626 |
T |
|
| Q |
105 |
caaagc |
110 |
Q |
| |
|
|||||| |
|
|
| T |
20232627 |
caaagc |
20232632 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 177 - 246
Target Start/End: Original strand, 20232703 - 20232771
Alignment:
| Q |
177 |
gatgatgttacaaataatatnnnnnnntactgacttacgaatcaatgcttgaaaataggacagctatatt |
246 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20232703 |
gatgatgttacaaataatataaaaaa-tactgacttacgaatcaatgcttgaaaataggacagctatatt |
20232771 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University