View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9612A_low_127 (Length: 256)
Name: NF9612A_low_127
Description: NF9612A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9612A_low_127 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 20 - 256
Target Start/End: Complemental strand, 2925704 - 2925468
Alignment:
| Q |
20 |
catcagacatcatcgattcaaccccctttctcaccaatcccggcaacggttcttcctccgatgacctcaacaactccggtcgccgccgccgccaacgcct |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
2925704 |
catcagacatcatcgattcaaccccctttctcaccaatcctggcaacggttcttcctccgatgacctcaacaactccggtcgccgtcgccgccaacgcct |
2925605 |
T |
|
| Q |
120 |
cctccaagccgcacgcttccttcgtcaagcaagcggccgtcgaacgatgcgggaaccctccgtcgtcgttcgcgaagccgcggcagagcaattagaagaa |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
2925604 |
cctccaagccgcacgcttccttcgtcaagcaagcggccgtcgaacgatgcgggaaccctccgtcgtcgttcgcgaagccgcggctgagcaattagaagaa |
2925505 |
T |
|
| Q |
220 |
cgacaaagcgattgggcgtattcgaagccggttgtga |
256 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2925504 |
cgacaaagcgattgggcgtattcgaagccggttgtga |
2925468 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 197 - 256
Target Start/End: Original strand, 42646231 - 42646290
Alignment:
| Q |
197 |
ccgcggcagagcaattagaagaacgacaaagcgattgggcgtattcgaagccggttgtga |
256 |
Q |
| |
|
||||||| |||||||| |||||||| ||||| |||||||| |||||||||||||| |||| |
|
|
| T |
42646231 |
ccgcggctgagcaattggaagaacggcaaagtgattgggcttattcgaagccggtggtga |
42646290 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University