View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9612A_low_131 (Length: 253)
Name: NF9612A_low_131
Description: NF9612A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9612A_low_131 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 10 - 235
Target Start/End: Original strand, 46300941 - 46301166
Alignment:
| Q |
10 |
atgagatgaatcagaaagatagctacataggcatagggataaaaacgatatttacagaatgcgagtgaaggcgcgtgagagataaataacagtgggaaat |
109 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
46300941 |
atgaaatgaatcagaaagatagctacataggcatagggataaaaacgatatttacagcatgcgagtgaaggtgcgtgagagataaataacagtgggaaat |
46301040 |
T |
 |
| Q |
110 |
gacggcgagaacatccagtataacacagtgacactcatcaaacgtcgtttcaccgccgtttcactatttctctctcttcattacacattcttctgtcttt |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
46301041 |
gacggcgagaacatccagtataacacagtgacactcatcaaacgtcgtttcaccgccgtttcactatttctctctcttcattacacattcttctgtgttt |
46301140 |
T |
 |
| Q |
210 |
accttacacttcacgccaaacgcctg |
235 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
46301141 |
accttacacttcacgccaaacgcctg |
46301166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University