View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9612A_low_153 (Length: 247)
Name: NF9612A_low_153
Description: NF9612A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9612A_low_153 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 135; Significance: 2e-70; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 78 - 240
Target Start/End: Complemental strand, 32723091 - 32722929
Alignment:
| Q |
78 |
gctagtttaattgattttgtgtctaaattttttaaaagttcaatatttatagaccaacacttatccatacttgccaaaacggataatgtgtgaatgctcc |
177 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||| |
|
|
| T |
32723091 |
gctagtttaattgattttgtgtctaaattttttaaaagttcaatatttatagaccaacacttatccatacttgccaaaacggataatgcgtgagtgctcc |
32722992 |
T |
 |
| Q |
178 |
cattgtaggggatacatgacgccctatgtttttctcgatttcttagtttcacgatattcttcg |
240 |
Q |
| |
|
| ||| |||||||||||||||||||||||||| ||||||||||||||||||||| ||| |||| |
|
|
| T |
32722991 |
cgttgcaggggatacatgacgccctatgttttcctcgatttcttagtttcacgacatttttcg |
32722929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University