View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9612A_low_160 (Length: 245)

Name: NF9612A_low_160
Description: NF9612A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9612A_low_160
NF9612A_low_160
[»] chr1 (11 HSPs)
chr1 (21-245)||(25700963-25701190)
chr1 (103-234)||(12318366-12318497)
chr1 (100-216)||(9109279-9109396)
chr1 (91-143)||(16216427-16216478)
chr1 (100-204)||(25652276-25652380)
chr1 (73-174)||(38746617-38746716)
chr1 (103-143)||(13547023-13547064)
chr1 (103-143)||(13548934-13548975)
chr1 (100-157)||(41136010-41136066)
chr1 (103-187)||(10157818-10157901)
chr1 (100-143)||(29136438-29136482)
[»] chr3 (7 HSPs)
chr3 (100-228)||(5270563-5270692)
chr3 (100-245)||(50432473-50432619)
chr3 (100-243)||(1683664-1683808)
chr3 (100-243)||(20937848-20937991)
chr3 (100-245)||(49031979-49032123)
chr3 (100-178)||(49199364-49199442)
chr3 (119-196)||(35138583-35138659)
[»] chr5 (6 HSPs)
chr5 (100-197)||(8038390-8038486)
chr5 (102-235)||(316956-317092)
chr5 (103-243)||(33905858-33905998)
chr5 (103-243)||(10054649-10054789)
chr5 (106-175)||(4160796-4160864)
chr5 (100-225)||(10700501-10700626)
[»] chr4 (13 HSPs)
chr4 (119-243)||(41961609-41961732)
chr4 (101-242)||(33990037-33990177)
chr4 (103-178)||(6199766-6199842)
chr4 (100-178)||(3786153-3786231)
chr4 (114-216)||(6719761-6719862)
chr4 (103-196)||(12073586-12073678)
chr4 (101-139)||(40974970-40975008)
chr4 (100-178)||(12119735-12119813)
chr4 (100-158)||(33090071-33090129)
chr4 (103-143)||(27416899-27416940)
chr4 (100-175)||(32091632-32091706)
chr4 (103-178)||(26699341-26699416)
chr4 (103-178)||(55085341-55085416)
[»] chr8 (9 HSPs)
chr8 (100-232)||(11137217-11137349)
chr8 (100-196)||(3772382-3772477)
chr8 (103-178)||(7624846-7624919)
chr8 (104-212)||(10240318-10240426)
chr8 (208-245)||(32429705-32429742)
chr8 (103-143)||(40221938-40221979)
chr8 (100-139)||(2999740-2999780)
chr8 (101-204)||(9633488-9633590)
chr8 (103-178)||(11384178-11384253)
[»] chr7 (9 HSPs)
chr7 (99-224)||(43363321-43363447)
chr7 (100-196)||(5116797-5116893)
chr7 (91-164)||(14301374-14301446)
chr7 (103-178)||(8452099-8452173)
chr7 (99-165)||(22552498-22552563)
chr7 (100-143)||(22328323-22328367)
chr7 (100-197)||(8359197-8359293)
chr7 (100-196)||(1360054-1360150)
chr7 (100-196)||(29608927-29609023)
[»] chr2 (8 HSPs)
chr2 (100-245)||(28197084-28197227)
chr2 (88-178)||(16676408-16676498)
chr2 (100-177)||(30217945-30218022)
chr2 (103-194)||(42261368-42261457)
chr2 (105-145)||(36282852-36282892)
chr2 (105-143)||(7451314-7451353)
chr2 (101-178)||(34811121-34811197)
chr2 (103-143)||(45727122-45727161)
[»] scaffold0002 (1 HSPs)
scaffold0002 (103-194)||(490203-490292)
[»] chr6 (1 HSPs)
chr6 (136-194)||(11660831-11660888)
[»] scaffold0197 (1 HSPs)
scaffold0197 (103-178)||(1295-1370)


Alignment Details
Target: chr1 (Bit Score: 186; Significance: 1e-101; HSPs: 11)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 21 - 245
Target Start/End: Complemental strand, 25701190 - 25700963
Alignment:
21 aaaagtgttagtagagttttatttgggctggtcaaattatgtcgaactaga---aaaatccttgctgtgtttattttatatactctactctctttatctt 117  Q
    |||||||||| |||||||||||||||||||||||||||||| |||||| ||   ||||||||||||||||||||||| ||||||||||||||||||||||    
25701190 aaaagtgttactagagttttatttgggctggtcaaattatgccgaactggatgaaaaatccttgctgtgtttattttctatactctactctctttatctt 25701091  T
118 gttattctttggttcgattgtggtttgtgctttatacttggttgctagattcgatctagatctatcgttgttgcttgtgactattttagatattggttgg 217  Q
    |||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |    
25701090 gttattttttggttcggttgtggtttgtgctttatacttggttgctagattcgatctagatctatcgttgttgcttgtgactattttagatattggtttg 25700991  T
218 cattgatatttgtcccacacatctaagt 245  Q
    ||||||||||||||||||||||||||||    
25700990 cattgatatttgtcccacacatctaagt 25700963  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 103 - 234
Target Start/End: Complemental strand, 12318497 - 12318366
Alignment:
103 tactctctttatcttgtt-attctttggttcgattgtggtttgtgctttatacttggttgctagattcgatctagatctatcgttgttgcttgtgactat 201  Q
    ||||| |||||||||||| |||||||||||| ||| || ||| ||||||| | ||||||||||| ||  |||||||||| | |||||||| ||||  |||    
12318497 tactccctttatcttgtttattctttggttcaattatgattt-tgctttacaattggttgctaggttaaatctagatctgttgttgttgcgtgtgcttat 12318399  T
202 tttagatattggttggcattgatatttgtccca 234  Q
    ||| | ||||||||| |||||||| ||| ||||    
12318398 tttggttattggttgccattgatacttgcccca 12318366  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 100 - 216
Target Start/End: Complemental strand, 9109396 - 9109279
Alignment:
100 ctctactctctttatcttg--ttattctttggttcgattgtggtttgtgctttatacttggttgctagattcgatctagatctatcgttgttgcttgtga 197  Q
    ||||||||||||||||||   ||||||||||||| ||||||||||  ||||| | | ||||||||||| || ||||||||||| | ||| || ||||||     
9109396 ctctactctctttatctttgtttattctttggtttgattgtggtta-tgcttcacagttggttgctagcttagatctagatctgttgttattacttgtgg 9109298  T
198 ctattttagatattggttg 216  Q
     |||||||| |||||||||    
9109297 ttattttagttattggttg 9109279  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 91 - 143
Target Start/End: Complemental strand, 16216478 - 16216427
Alignment:
91 ttttatatactctactctctttatcttgttattctttggttcgattgtggttt 143  Q
    ||||||||||||||| |||||||||| |||||||||| |||||||||||||||    
16216478 ttttatatactctac-ctctttatctcgttattctttagttcgattgtggttt 16216427  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 100 - 204
Target Start/End: Original strand, 25652276 - 25652380
Alignment:
100 ctctactctctttatcttgtt-attctttggttcgattgtggtttgtgctttatacttggttgctagattcgatctagatctatcgttgttgcttgtgac 198  Q
    ||||||||||||||| ||||| ||| ||||||| |  |||||||| ||||||| |||| ||||||||||| |||||| || | | |||||| |||||||     
25652276 ctctactctctttattttgtttattatttggtttgcctgtggttt-tgctttacacttagttgctagattagatctaaatttgttgttgttacttgtgat 25652374  T
199 tatttt 204  Q
    ||||||    
25652375 tatttt 25652380  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 73 - 174
Target Start/End: Complemental strand, 38746716 - 38746617
Alignment:
73 aaatccttgctgtgtttattttatatactctactctctttatcttgttattctttggttcgattgtggtttgtgctttatacttggttgctagattcgat 172  Q
    ||||||||| ||||||  || |||||||| |||||||||||||||||| ||||||| ||| |||||| |||| |||||| | ||| ||||||| || |||    
38746716 aaatccttggtgtgttg-ttctatatactatactctctttatcttgttgttctttgattcaattgtgatttg-gctttacagttgattgctagtttagat 38746619  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 103 - 143
Target Start/End: Complemental strand, 13547064 - 13547023
Alignment:
103 tactctctttatcttgtt-attctttggttcgattgtggttt 143  Q
    |||||||||||||||||| ||||||||||| |||||||||||    
13547064 tactctctttatcttgtttattctttggttggattgtggttt 13547023  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 103 - 143
Target Start/End: Complemental strand, 13548975 - 13548934
Alignment:
103 tactctctttatcttgtt-attctttggttcgattgtggttt 143  Q
    |||||||||||||||||| ||||||||||| |||||||||||    
13548975 tactctctttatcttgtttattctttggttggattgtggttt 13548934  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #9
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 100 - 157
Target Start/End: Original strand, 41136010 - 41136066
Alignment:
100 ctctactctctttatcttgttattctttggttcgattgtggtttgtgctttatacttg 157  Q
    ||||||||||||||||||||||||||||| |||  ||||| ||| ||||||| |||||    
41136010 ctctactctctttatcttgttattctttgattcagttgtgattt-tgctttacacttg 41136066  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #10
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 103 - 187
Target Start/End: Original strand, 10157818 - 10157901
Alignment:
103 tactctctttatcttgttattctttggttcgattgtggtttgtgctttatacttggttgctagattcgatctagatctatcgttg 187  Q
    ||||||||||||| |||| ||||||| |||||||||| | | | ||||| ||||| || ||| ||| ||||||||||||| ||||    
10157818 tactctctttatcctgttgttctttgattcgattgtgatat-tactttacacttgatttctaaatttgatctagatctattgttg 10157901  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #11
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 100 - 143
Target Start/End: Original strand, 29136438 - 29136482
Alignment:
100 ctctactctctttatcttg-ttattctttggttcgattgtggttt 143  Q
    ||||||||||||||||||| |||| |||||||| |||||||||||    
29136438 ctctactctctttatcttgtttatcctttggttagattgtggttt 29136482  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 63; Significance: 2e-27; HSPs: 7)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 100 - 228
Target Start/End: Original strand, 5270563 - 5270692
Alignment:
100 ctctactctctttatcttgtt-attctttggttcgattgtggtttgtgctttatacttggttgctagattcgatctagatctatcgttgttgcttgtgac 198  Q
    |||||||||||||||| |||| ||||||||||||||||||||||| ||| ||| |||||||||||||||| ||||||||||||| |||||||||||||      
5270563 ctctactctctttatcatgtttattctttggttcgattgtggttt-tgcattacacttggttgctagattagatctagatctattgttgttgcttgtggt 5270661  T
199 tatttta-gatattggttggcattgatattt 228  Q
    | ||||  | ||||||||| |||||||||||    
5270662 ttttttttgttattggttgtcattgatattt 5270692  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 100 - 245
Target Start/End: Complemental strand, 50432619 - 50432473
Alignment:
100 ctctactctctttatcttgttattctttggttcgattgtggtttgtgctttatacttggttgctagattcgatctagatctatcgttgttgcttgtgact 199  Q
    ||||||||||||||||||||| | |||||||| ||||||||||| ||||||  |||| ||||||||||| |||||||||||||  |||||||||||||||    
50432619 ctctactctctttatcttgttgt-ctttggtttgattgtggttt-tgctttccacttcgttgctagattggatctagatctattattgttgcttgtgact 50432522  T
200 ---attttagatattggttggcattgatatttgtcccacacatctaagt 245  Q
         ||| | | ||||||| ||||||||||||  ||||||||||||||    
50432521 gactgtttggttgttggttgccattgatatttgctccacacatctaagt 50432473  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 100 - 243
Target Start/End: Original strand, 1683664 - 1683808
Alignment:
100 ctctactctctttatcttgtta--ttctttggttcgattgtggtttgtgctttatacttggttgctagattcgatctagatctatcgttgttgcttgtga 197  Q
    |||||||||||||||||||||   || ||||||||||||||||||| |  |||| ||| |||| ||||||| ||||||||||||   |||||| ||||      
1683664 ctctactctctttatcttgtttatttttttggttcgattgtggttt-tattttacactaggtttctagattagatctagatctactattgttggttgtag 1683762  T
198 ctattttagatattggttggcattgatatttgtcccacacatctaa 243  Q
     ||| || | ||||||||| ||||||| ||||||||||||||||||    
1683763 ttatgttggttattggttgtcattgatgtttgtcccacacatctaa 1683808  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 100 - 243
Target Start/End: Original strand, 20937848 - 20937991
Alignment:
100 ctctactctctttatcttg-ttattctttggttcgattgtggtttgtgctttatacttggttgctagattcgatctagatctatcgttgttgcttgtgac 198  Q
    ||||||||||||||||||| ||||| ||||||||||||||| ||| | ||||| ||||| ||  |||||| ||||||||| | | |||| |||||||       
20937848 ctctactctctttatcttgtttattatttggttcgattgtgattt-tactttacacttgattaatagattagatctagatttgttgttgctgcttgtagt 20937946  T
199 tattttagatattggttggcattgatatttgtcccacacatctaa 243  Q
    ||||||   |||| |||| |||||||| |||||||||| ||||||    
20937947 tattttgcttattagttgtcattgatacttgtcccacaaatctaa 20937991  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 100 - 245
Target Start/End: Complemental strand, 49032123 - 49031979
Alignment:
100 ctctactctctttatcttgttattctttggttcgattgtggtttgtgctttatacttggttgctagattcgatctagatctatcgttgttgcttgtgact 199  Q
    |||||| || |||||||||||||||||| ||| ||| ||||||| ||  ||| | ||||||| ||| ||| | |||  ||| | | |||||||||||| |    
49032123 ctctacactatttatcttgttattctttagtttgat-gtggtttttgtcttacatttggttgttaggttcaacctatgtctgttggtgttgcttgtgaat 49032025  T
200 attttagatattggttggcattgatatttgtcccacacatctaagt 245  Q
    ||||| | ||||||||| ||||||  |||||||||||||| |||||    
49032024 attttggttattggttgtcattgacgtttgtcccacacatataagt 49031979  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 100 - 178
Target Start/End: Complemental strand, 49199442 - 49199364
Alignment:
100 ctctactctctttatcttg-ttattctttggttcgattgtggtttgtgctttatacttggttgctagattcgatctagat 178  Q
    ||||||||||||||||||| |||| |||||||| ||||||||||| |||| |  ||||| || ||||||| |||||||||    
49199442 ctctactctctttatcttgtttatcctttggttagattgtggttt-tgctatgcacttgttttctagattagatctagat 49199364  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 119 - 196
Target Start/End: Complemental strand, 35138659 - 35138583
Alignment:
119 ttattctttggttcgattgtggtttgtgctttatacttggttgctagattcgatctagatctatcgttgttgcttgtg 196  Q
    ||||||||||||||||||||||||| || |||| || |  |||||||||| |||||| || | | |||||||||||||    
35138659 ttattctttggttcgattgtggttt-tgttttacacctaattgctagattggatctaaatatgttgttgttgcttgtg 35138583  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 58; Significance: 2e-24; HSPs: 6)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 100 - 197
Target Start/End: Original strand, 8038390 - 8038486
Alignment:
100 ctctactctctttatcttgttattctttggttcgattgtggtttgtgctttatacttggttgctagattcgatctagatctatcgttgttgcttgtga 197  Q
    |||||||||||||||||| ||||| ||||||||||||||||||| | ||||| |||||||||||||||| |||| |||||||| ||||||| ||||||    
8038390 ctctactctctttatcttattattttttggttcgattgtggttt-ttctttacacttggttgctagattagatcaagatctattgttgttgattgtga 8038486  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 102 - 235
Target Start/End: Original strand, 316956 - 317092
Alignment:
102 ctactctctttatcttgtt-attctttggttcgattgtggtttgtgctttatacttggttgctagattcgatctagatctatc---gttgttgcttgtga 197  Q
    ||||||||||||| ||||| |||||||||||| |||||||||| ||||||| |||||||||||||||  ||||||||||| ||   |||||||||||||     
316956 ctactctctttattttgtttattctttggttcaattgtggttt-tgctttacacttggttgctagataagatctagatctgtcgttgttgttgcttgtgg 317054  T
198 ctattttagatattggttggcattgatatttgtcccac 235  Q
     |||||| | ||||||||| || ||||| |||||||||    
317055 ttattttggttattggttgtcactgatacttgtcccac 317092  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 103 - 243
Target Start/End: Complemental strand, 33905998 - 33905858
Alignment:
103 tactctctttatcttg-ttattctttggttcgattgtggtttgtgctttatacttggttgctagattcgatctagatctatcgttgttgcttgtgactat 201  Q
    |||||||||||||||| |||||| ||||||||| |||||||| | ||||| ||||| ||||||||||  |||| ||||||| |  ||||| || |  |||    
33905998 tactctctttatcttgtttattcattggttcgaatgtggttt-tactttacacttgattgctagattaaatcttgatctattggcgttgcgtgcggttat 33905900  T
202 tttagatattggttggcattgatatttgtcccacacatctaa 243  Q
    ||||| ||||||||| |||||||| ||||  |||| ||||||    
33905899 tttagttattggttgtcattgatacttgtttcacaaatctaa 33905858  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 103 - 243
Target Start/End: Complemental strand, 10054789 - 10054649
Alignment:
103 tactctctttatcttgtt-attctttggttcgattgtggtttgtgctttatacttggttgctagattcgatctagatctatcgttgttgcttgtgactat 201  Q
    |||||| ||||||||||| ||| |||| |||||||||  ||| ||||||| |||||||||||||||| ||||||||| | | | |||||| ||||  |||    
10054789 tactctttttatcttgtttattttttgcttcgattgtaattt-tgctttacacttggttgctagattagatctagatttgttgatgttgcatgtggttat 10054691  T
202 tttagatattggttggcattgatatttgtcccacacatctaa 243  Q
    |||   |||| |||| |||||||| |||||| ||| ||||||    
10054690 tttgattattagttgtcattgatacttgtcctacaaatctaa 10054649  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 106 - 175
Target Start/End: Original strand, 4160796 - 4160864
Alignment:
106 tctctttatcttgtt-attctttggttcgattgtggtttgtgctttatacttggttgctagattcgatcta 175  Q
    |||| |||||||||| |||||||||||||||| |||||| ||||||| ||||||||| |||||| ||||||    
4160796 tctcattatcttgtttattctttggttcgattatggttt-tgctttacacttggttg-tagattagatcta 4160864  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 100 - 225
Target Start/End: Complemental strand, 10700626 - 10700501
Alignment:
100 ctctactctctttatcttg-ttattctttggttcgattgtggtttgtgctttatacttggttgctagattcgatctagatctatcgttgttgcttgtgac 198  Q
    |||||| |||||||||||| |||||||||| || ||||||||||| || |||| ||||| ||| ||||||  || |||||| || ||| |||||||        
10700626 ctctacgctctttatcttgcttattctttgatttgattgtggttt-tgatttacacttgattgttagattaaatatagatccattgttattgcttgcagt 10700528  T
199 tattttagatattggttggcattgata 225  Q
    |||||| | ||||||||| ||||||||    
10700527 tattttggttattggttgtcattgata 10700501  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 53; Significance: 2e-21; HSPs: 13)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 119 - 243
Target Start/End: Original strand, 41961609 - 41961732
Alignment:
119 ttattctttggttcgattgtggtttgtgctttatacttggttgctagattcgatctagatctatcgttgttgcttgtgactattttagatattggttggc 218  Q
    ||||||||||||| ||||||||||| ||||||| || ||||| ||||||| ||||||||||||| ||||||||||||   | |||| | ||||||||| |    
41961609 ttattctttggtttgattgtggttt-tgctttaaacctggttactagattagatctagatctattgttgttgcttgtagtttttttggttattggttgtc 41961707  T
219 attgatatttgtcccacacatctaa 243  Q
    ||||||| ||| |||||| ||||||    
41961708 attgatacttgccccacagatctaa 41961732  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 101 - 242
Target Start/End: Original strand, 33990037 - 33990177
Alignment:
101 tctactctctttatcttgtt-attctttggttcgattgtggtttgtgctttatacttggttgctagattcgatctagatctatcgttgttgcttgtgact 199  Q
    |||||||||||||||||||| |||||||||||| ||| ||| || |||| |  |||||||| ||||||| ||||||||| | | |||||||||||||  |    
33990037 tctactctctttatcttgtttattctttggttcaattctggatt-tgctatgcacttggtttctagattagatctagat-tgttgttgttgcttgtgttt 33990134  T
200 attttagatattggttggcattgatatttgtcccacacatcta 242  Q
    ||||| | ||||| ||| |||||||| |||||||||| |||||    
33990135 attttggttattgattgccattgatacttgtcccacaaatcta 33990177  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 103 - 178
Target Start/End: Complemental strand, 6199842 - 6199766
Alignment:
103 tactctctttatcttgtta-ttctttggttcgattgtggtttgtgctttatacttggttgctagattcgatctagat 178  Q
    ||||||||||||||||||  |||||||||||||||||||||||||||||  | || |||| |||||| |||||||||    
6199842 tactctctttatcttgtttgttctttggttcgattgtggtttgtgctttgcaattagttgttagattagatctagat 6199766  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 100 - 178
Target Start/End: Original strand, 3786153 - 3786231
Alignment:
100 ctctactctctttatcttgtt-attctttggttcgattgtggtttgtgctttatacttggttgctagattcgatctagat 178  Q
    ||||||||||||||||||||| ||||||||||||||||||  ||| || |||| |||||||||||| ||| |||||||||    
3786153 ctctactctctttatcttgttcattctttggttcgattgtaattt-tgttttacacttggttgctatattagatctagat 3786231  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 114 - 216
Target Start/End: Original strand, 6719761 - 6719862
Alignment:
114 tcttgttattctttggttcgattgtggtttgtgctttatacttggttgctagattcgatctagatctatcgttgttgcttgtgactattttagatattgg 213  Q
    ||||||| ||||||||||  |||||||||| ||||||  |||||||| ||||||| ||||||||||| | ||| |||| ||||||| |||| | ||||||    
6719761 tcttgttgttctttggttttattgtggttt-tgctttgcacttggtttctagattagatctagatctgttgtttttgcctgtgactgttttggttattgg 6719859  T
214 ttg 216  Q
    |||    
6719860 ttg 6719862  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 103 - 196
Target Start/End: Original strand, 12073586 - 12073678
Alignment:
103 tactctctttatcttgtt-attctttggttcgattgtggtttgtgctttatacttggttgctagattcgatctagatctatcgttgttgcttgtg 196  Q
    |||||||||||||||||| ||||||||||| ||||||||||| || | |  |||||||| ||||||| ||||||||| | | |||||||||||||    
12073586 tactctctttatcttgtttattctttggttagattgtggttt-tgttatgcacttggtttctagattagatctagat-tgttgttgttgcttgtg 12073678  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 101 - 139
Target Start/End: Complemental strand, 40975008 - 40974970
Alignment:
101 tctactctctttatcttgttattctttggttcgattgtg 139  Q
    |||||||||||||||||||| ||||||||||||||||||    
40975008 tctactctctttatcttgttgttctttggttcgattgtg 40974970  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 100 - 178
Target Start/End: Original strand, 12119735 - 12119813
Alignment:
100 ctctactctctttatcttg-ttattctttggttcgattgtggtttgtgctttatacttggttgctagattcgatctagat 178  Q
    ||||||||||||||||||| ||| |||||||| |||||||||||| |||| |  |||| ||| ||||||| |||||||||    
12119735 ctctactctctttatcttgtttagtctttggtccgattgtggttt-tgctatgcacttagtttctagattagatctagat 12119813  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #9
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 100 - 158
Target Start/End: Original strand, 33090071 - 33090129
Alignment:
100 ctctactctctttatcttgtt-attctttggttcgattgtggtttgtgctttatacttgg 158  Q
    |||| |||||||||||||||| ||| ||||||||||||||||||| ||||||| ||||||    
33090071 ctctgctctctttatcttgtttattttttggttcgattgtggttt-tgctttacacttgg 33090129  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #10
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 103 - 143
Target Start/End: Complemental strand, 27416940 - 27416899
Alignment:
103 tactctctttatcttgtt-attctttggttcgattgtggttt 143  Q
    |||||||||||||||||| ||||||||||| |||||||||||    
27416940 tactctctttatcttgtttattctttggttggattgtggttt 27416899  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #11
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 100 - 175
Target Start/End: Original strand, 32091632 - 32091706
Alignment:
100 ctctactctctttatcttg-ttattctttggttcgattgtggtttgtgctttatacttggttgctagattcgatcta 175  Q
    |||||| |||||||||||| ||||||||| |||| |||||||||  | ||||| ||||| |||||||||| ||||||    
32091632 ctctacgctctttatcttgtttattctttagttcaattgtggtt--ttctttacacttgtttgctagattagatcta 32091706  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #12
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 103 - 178
Target Start/End: Complemental strand, 26699416 - 26699341
Alignment:
103 tactctctttatcttg-ttattctttggttcgattgtggtttgtgctttatacttggttgctagattcgatctagat 178  Q
    |||||||||||||||| |||||||||||||| ||| |||||| |||| |  |||||| | ||||||| |||||||||    
26699416 tactctctttatcttgtttattctttggttcaattatggttt-tgctatgcacttggattctagattagatctagat 26699341  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #13
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 103 - 178
Target Start/End: Complemental strand, 55085416 - 55085341
Alignment:
103 tactctctttatcttg-ttattctttggttcgattgtggtttgtgctttatacttggttgctagattcgatctagat 178  Q
    |||||||||||||||| |||||| |||||| ||||||||||| |||| |  |||||||| ||| ||| |||||||||    
55085416 tactctctttatcttgtttattccttggttggattgtggttt-tgctatgcacttggtttctaaattagatctagat 55085341  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 50; Significance: 1e-19; HSPs: 9)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 100 - 232
Target Start/End: Original strand, 11137217 - 11137349
Alignment:
100 ctctactctctttatcttgtt-attctttggttcgattgtggtttgtgctttatacttggttgctagattcgatctagatctatcgttgttgcttgtgac 198  Q
    ||||||||||||||||||||| |||| |||||||||||||||||| | ||||||||||| |||||||||| ||| ||||| | |  ||||||||||||      
11137217 ctctactctctttatcttgtttattcattggttcgattgtggttttt-ctttatacttgattgctagattagatttagatatgttattgttgcttgtggt 11137315  T
199 tattttagatattggttggcattgatatttgtcc 232  Q
    ||||||   ||| ||||| |||||||| ||||||    
11137316 tattttgattatcggttgtcattgatacttgtcc 11137349  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 100 - 196
Target Start/End: Original strand, 3772382 - 3772477
Alignment:
100 ctctactctctttatcttg-ttattctttggttcgattgtggtttgtgctttatacttggttgctagattcgatctagatctatcgttgttgcttgtg 196  Q
    ||||||||||||||||||| ||||||||||||| ||||||||||| |||| |  ||||| || |||||||  |||||||| | | |||||||||||||    
3772382 ctctactctctttatcttgtttattctttggttagattgtggttt-tgctatgcacttgatttctagattaaatctagat-tgttgttgttgcttgtg 3772477  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 103 - 178
Target Start/End: Complemental strand, 7624919 - 7624846
Alignment:
103 tactctctttatcttgttattctttggttcgattgtggtttgtgctttatacttggttgctagattcgatctagat 178  Q
    |||||||||| |||| || |||||||||||||||||||||| | ||||| || |||||||||| || |||||||||    
7624919 tactctctttgtcttattgttctttggttcgattgtggttt-tactttacacatggttgctag-ttagatctagat 7624846  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 104 - 212
Target Start/End: Original strand, 10240318 - 10240426
Alignment:
104 actctctttatcttgtta--ttctttggttcgattgtggtttgtgctttatacttggttgctagattcgatctagatctatcgttgttgcttgtgactat 201  Q
    |||||||||||||||||   || ||||||||||||||||||| ||||||| | || ||| ||||||| ||||||||| | | ||| ||| ||||| ||||    
10240318 actctctttatcttgtttatttttttggttcgattgtggttt-tgctttacatttcgtttctagattagatctagat-tgttgttattgtttgtggctat 10240415  T
202 tttagatattg 212  Q
    ||||| |||||    
10240416 tttagttattg 10240426  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 208 - 245
Target Start/End: Complemental strand, 32429742 - 32429705
Alignment:
208 tattggttggcattgatatttgtcccacacatctaagt 245  Q
    |||||||||  |||||||||||||||||||||||||||    
32429742 tattggttgcaattgatatttgtcccacacatctaagt 32429705  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 103 - 143
Target Start/End: Original strand, 40221938 - 40221979
Alignment:
103 tactctctttatcttgtt-attctttggttcgattgtggttt 143  Q
    |||||||||||||||||| ||||||||||| |||||||||||    
40221938 tactctctttatcttgttcattctttggttggattgtggttt 40221979  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #7
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 100 - 139
Target Start/End: Complemental strand, 2999780 - 2999740
Alignment:
100 ctctactctctttatcttg-ttattctttggttcgattgtg 139  Q
    ||||||||||||||||||| ||||||||||||| |||||||    
2999780 ctctactctctttatcttgtttattctttggttagattgtg 2999740  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #8
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 101 - 204
Target Start/End: Complemental strand, 9633590 - 9633488
Alignment:
101 tctactctctttatcttg-ttattctttggttcgattgtggtttgtgctttatacttggttgctagattcgatctagatctatcgttgttgcttgtgact 199  Q
    |||||||||||||||||| |||||||||||||| |||||| ||| |  |||| | ||| ||| || ||| ||||||||| | || ||||||||||||| |    
9633590 tctactctctttatcttgtttattctttggttcaattgtgattt-tattttacaattgattgttatattagatctagatttgtc-ttgttgcttgtgatt 9633493  T
200 atttt 204  Q
    |||||    
9633492 atttt 9633488  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #9
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 103 - 178
Target Start/End: Original strand, 11384178 - 11384253
Alignment:
103 tactctctttatcttg-ttattctttggttcgattgtggtttgtgctttatacttggttgctagattcgatctagat 178  Q
    |||||||||||||||| |||| |||||||| ||||||||||| |||| |  ||||| || ||||||| |||||||||    
11384178 tactctctttatcttgtttatcctttggttagattgtggttt-tgctatgcacttgttttctagattagatctagat 11384253  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 47; Significance: 6e-18; HSPs: 9)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 99 - 224
Target Start/End: Complemental strand, 43363447 - 43363321
Alignment:
99 actctactctctttatcttgtta-ttctttggttcgattgtggtttgtgctttatacttggttgctagattcgatctagatctatcgttgttgcttgtga 197  Q
    ||||||||||||||||||||||  |||||||||||||||||||||||||||||  |  | |||| |||||| ||||||||| | |  ||||||||||||     
43363447 actctactctctttatcttgtttgttctttggttcgattgtggtttgtgctttgcaaatagttgttagattagatctagatttgttattgttgcttgtgg 43363348  T
198 ctattttagatattggttggcattgat 224  Q
      ||||||| ||||||||  |||||||    
43363347 tcattttagttattggttaccattgat 43363321  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 100 - 196
Target Start/End: Original strand, 5116797 - 5116893
Alignment:
100 ctctactctctttatcttgttattctttggttcgattgtggtttgtgctttatacttggttgctagattc-gatctagatctatcgttgttgcttgtg 196  Q
    |||||| ||||||||||||||||| | |||||||||||||| || ||||||| |||||||| | |||||| ||||||||| ||| |||||||||||||    
5116797 ctctaccctctttatcttgttattatatggttcgattgtggatt-tgctttacacttggttacgagattcagatctagatatattgttgttgcttgtg 5116893  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 91 - 164
Target Start/End: Complemental strand, 14301446 - 14301374
Alignment:
91 ttttatatactctactctctttatcttgttattctttggttcgattgtggtttgtgctttatacttggttgcta 164  Q
    |||| ||||||||||||||||||||||||||||||||| || ||||||| ||| ||||| | |||| |||||||    
14301446 ttttctatactctactctctttatcttgttattctttgatttgattgtgattt-tgcttgacacttagttgcta 14301374  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 103 - 178
Target Start/End: Complemental strand, 8452173 - 8452099
Alignment:
103 tactctctttatcttgttattctttggttcgattgtggtttgtgctttatacttggttgctagattcgatctagat 178  Q
    |||||| |||||||||| ||||||||||||||||||||||| ||||||| | ||| ||  |||||| |||||||||    
8452173 tactctttttatcttgtcattctttggttcgattgtggttt-tgctttacatttgatttttagattagatctagat 8452099  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 99 - 165
Target Start/End: Complemental strand, 22552563 - 22552498
Alignment:
99 actctactctctttatcttgttattctttggttcgattgtggtttgtgctttatacttggttgctag 165  Q
    |||||||||||||||||||||| ||||||||| |||| | ||||| | ||||| |||||||||||||    
22552563 actctactctctttatcttgttgttctttggtacgatcgaggttt-ttctttacacttggttgctag 22552498  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 100 - 143
Target Start/End: Complemental strand, 22328367 - 22328323
Alignment:
100 ctctactctctttatcttgtt-attctttggttcgattgtggttt 143  Q
    ||||||||||||||||||||| ||||||| |||||||||||||||    
22328367 ctctactctctttatcttgtttattcttttgttcgattgtggttt 22328323  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #7
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 100 - 197
Target Start/End: Complemental strand, 8359293 - 8359197
Alignment:
100 ctctactctctttatcttgtt-attctttggttcgattgtggtttgtgctttatacttggttgctagattcgatctagatctatcgttgttgcttgtga 197  Q
    |||||||||| |||||||||| || |||||||| ||||||||||| |||| |  ||||| || ||||||| ||||||||| | | ||||||||||||||    
8359293 ctctactctcattatcttgtttatcctttggttagattgtggttt-tgctatgcacttgttttctagattagatctagat-tgttgttgttgcttgtga 8359197  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #8
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 100 - 196
Target Start/End: Complemental strand, 1360150 - 1360054
Alignment:
100 ctctactctctttatcttgtta-ttctttggttcgattgtggtttgtgctttatacttggttgctagattcgatctagatctatcgttgttgcttgtg 196  Q
    ||||| |||||||||||||||  |||||| ||||||||||||||| ||||||| |||| |||  |||||| |||||| |  | | |||||||||||||    
1360150 ctctattctctttatcttgtttcttcttttgttcgattgtggttt-tgctttacacttagtttttagattagatctaaaattgttgttgttgcttgtg 1360054  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #9
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 100 - 196
Target Start/End: Original strand, 29608927 - 29609023
Alignment:
100 ctctactctctttatcttg-ttattctttggttcgattgtggtttgtgctttatacttggttgctagattcgatctagatctatcgttgttgcttgtg 196  Q
    ||||||||||||||||||| |||| ||||| || ||||||||||| || | |  |||||||| ||| ||| ||||||||| | | |||||||||||||    
29608927 ctctactctctttatcttgtttatcctttgcttagattgtggtttttgatatgcacttggtttctatattagatctagat-tgttgttgttgcttgtg 29609023  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 46; Significance: 2e-17; HSPs: 8)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 100 - 245
Target Start/End: Original strand, 28197084 - 28197227
Alignment:
100 ctctactctctttatcttgttattctttggttcgattgtggtttgtgctttatacttggttgctagattcgatctagatctatcgttgttgcttgtgact 199  Q
    |||||||||||| ||| |||| ||||||| ||| ||||| | || ||||||| |||||||||||||||   |||||||| |  |||||||||||||||||    
28197084 ctctactctctt-atcatgttgttctttgattcaattgttggtt-tgctttacacttggttgctagataaaatctagatatgccgttgttgcttgtgact 28197181  T
200 attttagatattggttggcattgatatttgtcccacacatctaagt 245  Q
    |||||   ||||||||| ||||||||| |||| || |||| |||||    
28197182 attttgattattggttgccattgatatgtgtctcatacatttaagt 28197227  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 88 - 178
Target Start/End: Original strand, 16676408 - 16676498
Alignment:
88 ttattttatatactctactctctttatcttgtta-ttctttggttcgattgtggtttgtgctttatacttggttgctagattcgatctagat 178  Q
    ||||| ||||||||||||| ||||||||| |||  |||||||||||||||||||||| || |||| |||| ||||||||||| |||||||||    
16676408 ttattctatatactctactttctttatctagtttgttctttggttcgattgtggttt-tgatttacactttgttgctagattagatctagat 16676498  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 100 - 177
Target Start/End: Complemental strand, 30218022 - 30217945
Alignment:
100 ctctactctctttatcttg-ttattctttggttcgattgtggtttgtgctttatacttggttgctagattcgatctaga 177  Q
    ||||||||||||||||||| ||||||||||||| |||||||| ||||| |||| |||||||| ||||||| ||||||||    
30218022 ctctactctctttatcttgtttattctttggtttgattgtgg-ttgtgttttacacttggtttctagattggatctaga 30217945  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 103 - 194
Target Start/End: Complemental strand, 42261457 - 42261368
Alignment:
103 tactctctttatcttg-ttattctttggttcgattgtggtttgtgctttatacttggttgctagattcgatctagatctatcgttgttgcttg 194  Q
    |||||||||||||||| |||||  |||||| | ||||||||| |||| || |||||||||||||||| ||||||||| ||| |||||||||||    
42261457 tactctctttatcttgattatt--ttggtttgtttgtggttt-tgctatacacttggttgctagattagatctagatatattgttgttgcttg 42261368  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 105 - 145
Target Start/End: Complemental strand, 36282892 - 36282852
Alignment:
105 ctctctttatcttgttattctttggttcgattgtggtttgt 145  Q
    |||||||||||||||||||||||| |||||||||| |||||    
36282892 ctctctttatcttgttattctttgattcgattgtgctttgt 36282852  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 105 - 143
Target Start/End: Original strand, 7451314 - 7451353
Alignment:
105 ctctctttatcttgtt-attctttggttcgattgtggttt 143  Q
    |||||||||||||||| |||||||||||||||||||||||    
7451314 ctctctttatcttgtttattctttggttcgattgtggttt 7451353  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 101 - 178
Target Start/End: Complemental strand, 34811197 - 34811121
Alignment:
101 tctactctctttatcttgttattctttggttcgattgtggtttgtgctttatacttggttgctagattcgatctagat 178  Q
    |||||||||||||||||||| ||||||  |||| |||| |||| | ||||| | || ||||||||||| |||||||||    
34811197 tctactctctttatcttgttgttcttttattcggttgtagttt-tactttacaattagttgctagattagatctagat 34811121  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #8
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 103 - 143
Target Start/End: Original strand, 45727122 - 45727161
Alignment:
103 tactctctttatcttgttattctttggttcgattgtggttt 143  Q
    ||||||||||||||| ||||||||||||| |||||||||||    
45727122 tactctctttatctt-ttattctttggttggattgtggttt 45727161  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0002 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: scaffold0002
Description:

Target: scaffold0002; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 103 - 194
Target Start/End: Complemental strand, 490292 - 490203
Alignment:
103 tactctctttatcttg-ttattctttggttcgattgtggtttgtgctttatacttggttgctagattcgatctagatctatcgttgttgcttg 194  Q
    |||||||||||||||| |||||  |||||| | ||||||||| |||| || |||||||||||||||| ||||||||| ||| |||||||||||    
490292 tactctctttatcttgattatt--ttggtttgtttgtggttt-tgctatacacttggttgctagattagatctagatatattgttgttgcttg 490203  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 136 - 194
Target Start/End: Original strand, 11660831 - 11660888
Alignment:
136 tgtggtttgtgctttatacttggttgctagattcgatctagatctatcgttgttgcttg 194  Q
    |||||||| ||||||| |||||||||||||||| ||||||||||| | |||||||||||    
11660831 tgtggttt-tgctttacacttggttgctagattagatctagatctgttgttgttgcttg 11660888  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0197 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: scaffold0197
Description:

Target: scaffold0197; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 103 - 178
Target Start/End: Complemental strand, 1370 - 1295
Alignment:
103 tactctctttatcttgtt-attctttggttcgattgtggtttgtgctttatacttggttgctagattcgatctagat 178  Q
    ||||||||||||||| || ||| ||||||| ||||||||||| | ||||| |||||||| ||||||| |||||||||    
1370 tactctctttatcttatttattttttggtttgattgtggttt-tactttacacttggtttctagattagatctagat 1295  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University