View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9612A_low_163 (Length: 245)
Name: NF9612A_low_163
Description: NF9612A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9612A_low_163 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 172; Significance: 2e-92; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 4 - 240
Target Start/End: Complemental strand, 35992787 - 35992548
Alignment:
| Q |
4 |
atgaatagttagcatgaggaggagaggtaattcggtcaataccctgccaatctgatatgacaaaaccctgcaagatggaagaaaagttacatgatatgta |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35992787 |
atgaatagttagcatgaggaggagaggtaattcggtcaataccctgccaatctgatatgacaaaaccctgcaagatggaagaaaagttacatgatatgta |
35992688 |
T |
 |
| Q |
104 |
gctatctaca---tcnnnnnnngacttaagttcnnnnnnnnnnnttaattggaaatctatttagataaattgttttaccctgaaccgcagtttgttcttg |
200 |
Q |
| |
|
|||||||||| || ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35992687 |
gctatctacatcttctttttttgacttaagttcaatttttttttttaattggaaatctatttagataaattgttttaccctgaaccgcagtttgttcttg |
35992588 |
T |
 |
| Q |
201 |
aggtaaccagtgacaagatcacggttagcatgcatctttt |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35992587 |
aggtaaccagtgacaagatcacggttagcatgcatctttt |
35992548 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 9 - 75
Target Start/End: Complemental strand, 10004180 - 10004114
Alignment:
| Q |
9 |
tagttagcatgaggaggagaggtaattcggtcaataccctgccaatctgatatgacaaaaccctgca |
75 |
Q |
| |
|
||||||||||||||||| || || || | |||||| |||| |||||||||||||||||||||||||| |
|
|
| T |
10004180 |
tagttagcatgaggaggtgaagttatcctgtcaattcccttccaatctgatatgacaaaaccctgca |
10004114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 9 - 75
Target Start/End: Complemental strand, 9998464 - 9998398
Alignment:
| Q |
9 |
tagttagcatgaggaggagaggtaattcggtcaataccctgccaatctgatatgacaaaaccctgca |
75 |
Q |
| |
|
||||||||||||||||| || || || | ||| || |||| |||||||||||||||||||||||||| |
|
|
| T |
9998464 |
tagttagcatgaggaggtgaagttatcctgtcgattccctcccaatctgatatgacaaaaccctgca |
9998398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 12 - 75
Target Start/End: Complemental strand, 9991306 - 9991243
Alignment:
| Q |
12 |
ttagcatgaggaggagaggtaattcggtcaataccctgccaatctgatatgacaaaaccctgca |
75 |
Q |
| |
|
||||||||||| || || || || | |||||| |||| |||||||||||||||||||||||||| |
|
|
| T |
9991306 |
ttagcatgaggcggggaagttatcctgtcaattccctcccaatctgatatgacaaaaccctgca |
9991243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University