View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9612A_low_171 (Length: 243)
Name: NF9612A_low_171
Description: NF9612A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9612A_low_171 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 5 - 243
Target Start/End: Original strand, 45077784 - 45078022
Alignment:
| Q |
5 |
actgagatgaatattcataatttaactataagtatattttggaatatgttttcataaaggaaaaagaaataattttagaaaaaatgagttagcattaaaa |
104 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45077784 |
actgaaatgaatattcataatttaactataagtataatttggaatatgttttcataaaggaaaaagaaataattttagaaaaaatgagttagcattaaaa |
45077883 |
T |
|
| Q |
105 |
tgtgttgatttgatacttgcagagggtgttctaacagctgttcaaaccttggcatcaacttcaatatgtggcattatacactcaatcattggtggtcaac |
204 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45077884 |
tgtgttgatttgatatttgcagagggtgttctaacagctgttcaaaccttggcatcaacttcaatatgtggcattatacactcaatcattggtggtcaac |
45077983 |
T |
|
| Q |
205 |
ctttactgattttcggagtggcagaacctactgtgatca |
243 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
45077984 |
ctttactgattttaggagtggcagaacctactgtgatca |
45078022 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University