View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9612A_low_187 (Length: 237)
Name: NF9612A_low_187
Description: NF9612A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9612A_low_187 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 52 - 220
Target Start/End: Original strand, 48993496 - 48993664
Alignment:
| Q |
52 |
gacagatagtttggaaattttggcaggtgcaatggtgccttgtgtgatgcttatactagggggtatgctagctgaaggaccaaatgaatcaacacttgga |
151 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48993496 |
gacagatagtttggaaattttggcaggtgcaatggtgccttgtgtgatgcttatactagggggtatgctagctgaaggaccaaatgaatcaacacttgga |
48993595 |
T |
|
| Q |
152 |
attaaaactacaattgggataattgtggcaagacttgtggtgcttcctgttataggaattggtgttgtt |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
48993596 |
attaaaactacaattgggataattgtggcaagacttgtggtgcttcctgttataggaattggagttgtt |
48993664 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 70; Significance: 1e-31; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 53 - 202
Target Start/End: Complemental strand, 22624233 - 22624084
Alignment:
| Q |
53 |
acagatagtttggaaattttggcaggtgcaatggtgccttgtgtgatgcttatactagggggtatgctagctgaaggaccaaatgaatcaacacttggaa |
152 |
Q |
| |
|
||||||||||| || ||||| | |||||||||||||||| ||||||||||||| ||||||||||||| ||||||||||||||||| || | ||||||| |
|
|
| T |
22624233 |
acagatagtttagagattttaggtggtgcaatggtgccttctgtgatgcttatattagggggtatgcttgctgaaggaccaaatgagtctagacttggac |
22624134 |
T |
|
| Q |
153 |
ttaaaactacaattgggataattgtggcaagacttgtggtgcttcctgtt |
202 |
Q |
| |
|
||| |||||| ||||| || ||||||||||||| ||||||| |||||| |
|
|
| T |
22624133 |
ttagaactactattggtattgttgtggcaagactcttggtgctacctgtt |
22624084 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University