View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9612A_low_196 (Length: 232)
Name: NF9612A_low_196
Description: NF9612A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9612A_low_196 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 122; Significance: 1e-62; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 70 - 199
Target Start/End: Original strand, 47358642 - 47358771
Alignment:
| Q |
70 |
atttgtacaaagctttacaagccaggcagacccaccagagatggcctaaaaggacagtgatgatgaaccacatgcatgcatgtttatgtttatctataat |
169 |
Q |
| |
|
|||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47358642 |
atttatacaaagctttacaagtcaggcagacccaccagagatggcctaaaaggacagtgatgatgaaccacatgcatgcatgtttatgtttatctataat |
47358741 |
T |
 |
| Q |
170 |
agcaaaactttagggtactcatcatgtaat |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
47358742 |
agcaaaactttagggtactcatcatgtaat |
47358771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University