View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9612A_low_197 (Length: 231)
Name: NF9612A_low_197
Description: NF9612A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9612A_low_197 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 182; Significance: 2e-98; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 3 - 225
Target Start/End: Complemental strand, 43383570 - 43383348
Alignment:
| Q |
3 |
gaacacacaaactgatcattctcatcgaccatcaccgttgttgttgattttgct---gctttcttgttctttggatttgaattagcaagtaagagcaaag |
99 |
Q |
| |
|
||||||||||||||||||| ||||||||||| |||||||||||| ||||||| |||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
43383570 |
gaacacacaaactgatcatcctcatcgacca---ccgttgttgttgcttttgcttttgctttcttgttctttggatttgaattagaaagtaagagcaaag |
43383474 |
T |
|
| Q |
100 |
aagcagcaccttcctgttcttctggagtcacaacaagttgttgtcttctgaaattaggaggagggttaatgcctctccattcacgctcaggatgacaacg |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43383473 |
aagcagcaccttcctgttcttctggagtcacaacaagttgttgtcttctgaaattaggtggagggttaatgcctctccattcacgctcaggatgacaacg |
43383374 |
T |
|
| Q |
200 |
catatgaccaaaaagagccttccatg |
225 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
43383373 |
catatgaccaaaaagagccttccatg |
43383348 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 60 - 225
Target Start/End: Complemental strand, 25870237 - 25870069
Alignment:
| Q |
60 |
ttcttgttctttggatttgaattagcaagtaagagcaaagaagcagcaccttcctgttcttctggagtcacaa---caagttgttgtcttctgaaattag |
156 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
25870237 |
ttcttgttctttggatttgaattagcaagtaaaagcaaagaagcagcaccttcctgttcttctggagtcacaagttgttgttgttgtcttctgaaattag |
25870138 |
T |
|
| Q |
157 |
gaggagggttaatgcctctccattcacgctcaggatgacaacgcatatgaccaaaaagagccttccatg |
225 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25870137 |
gaggagggttaatgcctctccattgacgctcaggatgacaacgcatatgaccaaaaagagccttccatg |
25870069 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University