View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9612A_low_205 (Length: 230)
Name: NF9612A_low_205
Description: NF9612A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9612A_low_205 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 172; Significance: 1e-92; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 1 - 229
Target Start/End: Complemental strand, 9452461 - 9452234
Alignment:
| Q |
1 |
taaaaggacatgaattttataacttacaccccttagatattttctcatctattcccattaatattcacaatccttgattttatnnnnnnnttacacatca |
100 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||| |||||| |||| ||| ||||| |||||||||||||||||| |||||||||| |
|
|
| T |
9452461 |
taaaaggacatgaattttataacttacacaccttagatattt-ctcatccattctcatgaatatgcacaatccttgattttataaaaaaattacacatca |
9452363 |
T |
|
| Q |
101 |
ttattaaggaatagttaataatattacctgttttcgtgtcatacagtttcaaccaggagcatgcttggcagcaggaaagaatatccgaggcatgtgccgt |
200 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
9452362 |
ttattaaggaatatttaataatattacctgttttcgtgtcatacagtttcaaccaggagcatgcttggcagcaggaaagaatatccgaggcatgtgtcgt |
9452263 |
T |
|
| Q |
201 |
gcacaaaaacgtgtatggttttcccaagg |
229 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
9452262 |
gcacaaaaacgtgtatggttttcccaagg |
9452234 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 136 - 229
Target Start/End: Complemental strand, 9441101 - 9441008
Alignment:
| Q |
136 |
gtgtcatacagtttcaaccaggagcatgcttggcagcaggaaagaatatccgaggcatgtgccgtgcacaaaaacgtgtatggttttcccaagg |
229 |
Q |
| |
|
||||||||||||||| ||||||||||| |||||||||| ||||||||||||||||||||| |||||||||| | ||||||||||| ||||| |
|
|
| T |
9441101 |
gtgtcatacagtttcttccaggagcatgtttggcagcagaaaagaatatccgaggcatgtgttgtgcacaaaattgcgtatggttttctcaagg |
9441008 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University