View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9612A_low_218 (Length: 228)
Name: NF9612A_low_218
Description: NF9612A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9612A_low_218 |
 | |
|
| [»] scaffold0110 (3 HSPs) |
| |
|
Alignment Details
Target: scaffold0110 (Bit Score: 211; Significance: 1e-116; HSPs: 3)
Name: scaffold0110
Description:
Target: scaffold0110; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 6 - 228
Target Start/End: Original strand, 13061 - 13283
Alignment:
| Q |
6 |
aaagattttgcggattatgcagatttctgtttcaaaacatttggagacagagttaagaactggatgactttcaatgaactaagagttattgctgcacttt |
105 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
13061 |
aaagattttgcggattatgcagatttttgtttcaaaacatttggagacagagttaagaactggatgactttcaatgaaccaagagttattgctgcacttg |
13160 |
T |
|
| Q |
106 |
gttatgatactggcttttttgcccctggaaggtgttcaaaagaatatggaaattgtactgctggaaattcaggaactgagccttatattgtagctcacaa |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13161 |
gttatgatactggcttttttgcccctggaaggtgttcaaaagaatatggaaattgtactgctggaaattcaggaactgagccttatattgtagctcacaa |
13260 |
T |
|
| Q |
206 |
tttgatattgtcacatgctgctg |
228 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
13261 |
tttgatattgtcacatgctgctg |
13283 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0110; HSP #2
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 6 - 228
Target Start/End: Original strand, 20798 - 21020
Alignment:
| Q |
6 |
aaagattttgcggattatgcagatttctgtttcaaaacatttggagacagagttaagaactggatgactttcaatgaactaagagttattgctgcacttt |
105 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
20798 |
aaagattttgcggattatgcagatttttgtttcaaaacatttggagacagagttaagaactggatgactttcaatgaaccaagagttattgctgcacttg |
20897 |
T |
|
| Q |
106 |
gttatgatactggcttttttgcccctggaaggtgttcaaaagaatatggaaattgtactgctggaaattcaggaactgagccttatattgtagctcacaa |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20898 |
gttatgatactggcttttttgcccctggaaggtgttcaaaagaatatggaaattgtactgctggaaattcaggaactgagccttatattgtagctcacaa |
20997 |
T |
|
| Q |
206 |
tttgatattgtcacatgctgctg |
228 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
20998 |
tttgatattgtcacatgctgctg |
21020 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0110; HSP #3
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 6 - 228
Target Start/End: Original strand, 29918 - 30140
Alignment:
| Q |
6 |
aaagattttgcggattatgcagatttctgtttcaaaacatttggagacagagttaagaactggatgactttcaatgaactaagagttattgctgcacttt |
105 |
Q |
| |
|
|||||||||||||||||||||||||| ||||| || ||||||||||||||||||||||| |||||||| |||||||||| ||||||| ||||||||||| |
|
|
| T |
29918 |
aaagattttgcggattatgcagatttttgttttaagacatttggagacagagttaagaattggatgaccttcaatgaaccaagagttgttgctgcacttg |
30017 |
T |
|
| Q |
106 |
gttatgatactggcttttttgcccctggaaggtgttcaaaagaatatggaaattgtactgctggaaattcaggaactgagccttatattgtagctcacaa |
205 |
Q |
| |
|
||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
30018 |
gttatgataatggcttttttgcccctggaagatgttcaaaagaatatggaaattgtacagctggaaattcaggaactgagccttatactgtagctcacaa |
30117 |
T |
|
| Q |
206 |
tttgatattgtcacatgctgctg |
228 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
30118 |
tttgatattgtcacatgctgctg |
30140 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 36 - 84
Target Start/End: Original strand, 31639059 - 31639107
Alignment:
| Q |
36 |
ttcaaaacatttggagacagagttaagaactggatgactttcaatgaac |
84 |
Q |
| |
|
|||||| | |||||||||||||||||| ||||||| || |||||||||| |
|
|
| T |
31639059 |
ttcaaagcttttggagacagagttaagcactggattaccttcaatgaac |
31639107 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University