View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9612A_low_220 (Length: 227)
Name: NF9612A_low_220
Description: NF9612A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9612A_low_220 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 12 - 227
Target Start/End: Original strand, 23524057 - 23524272
Alignment:
| Q |
12 |
aatactcgaggatttcttcagctaatctagggacatgaatagggtcaatgttgggtggggctatttttgtcaaaacgaagatgacgacggcaaacagggc |
111 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||| || ||||||||||||||||||||||||||||| ||||| |
|
|
| T |
23524057 |
aatactcgaggatttcttcagctagtctagggacatgaatagggtcattgttgggtggggtgatctttgtcaaaacgaagatgacgacggcaaatagggc |
23524156 |
T |
|
| Q |
112 |
agtagagaaaaagagtggaaagtagaaggttaccatggtaatgatgaaggggagaagatggatgaaaatgaaaatggctaggaaagaaatgagggcccca |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23524157 |
agtagagaaaaagagtggaaagtagaaggttaccatggtaatgatgaaggggagaagatggatgaaaatgaaaatggctaggaaagaaatgagggcccca |
23524256 |
T |
|
| Q |
212 |
ctgatgtagggtttga |
227 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
23524257 |
ctgatgtagggtttga |
23524272 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University