View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9612A_low_223 (Length: 227)
Name: NF9612A_low_223
Description: NF9612A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9612A_low_223 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 37346068 - 37345859
Alignment:
| Q |
1 |
aagtttagccaccgtctttaatgatttggataaaagtaatggctcaattcaggtaattaacaataccttatattacattaactgatctaaagtttagcta |
100 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||| |
|
|
| T |
37346068 |
aagtttagccactgtctttaatgatttggataaaagtaatggctcaattcaggtaattaacaataccttatattacattacctgacctaaagtttagcta |
37345969 |
T |
|
| Q |
101 |
gtatcttctaattttgcatgtcacttttggttttccttttcaggatagaggttcacttcttatgtttgtgttttcattcctaactttcatgaccattggt |
200 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37345968 |
gtatcttctaattttgcatgtcact-----------ttttcaggatagaggttcacttcttatgtttgtgttttcattcctaactttcatgaccattggt |
37345880 |
T |
|
| Q |
201 |
ggattcccttcttatgtggag |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
37345879 |
ggattcccttcttatgtggag |
37345859 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University