View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9612A_low_236 (Length: 220)
Name: NF9612A_low_236
Description: NF9612A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9612A_low_236 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 144; Significance: 7e-76; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 144; E-Value: 7e-76
Query Start/End: Original strand, 37 - 203
Target Start/End: Original strand, 3428650 - 3428817
Alignment:
| Q |
37 |
agttatgctcatattaaaa-atctagttatgcttttcgagacaagcgaaaaattagagcacattcaagaagaagatgcaattggctggtccttgaaatga |
135 |
Q |
| |
|
||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
3428650 |
agttatgctcataataaaaaatctagttatgcttttcgagacaagcgaaaaattagagcacattcaagaagaagatgcaattggctggtccttggaatga |
3428749 |
T |
|
| Q |
136 |
gaggaaaactcctaaaattccaatccctatcaccatataaagagaccaaagagtagtgtaccgaatga |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||| |
|
|
| T |
3428750 |
gaggaaaactcctaaaattccaatccctatcaccatataaagagaccaaaaagtagtgtaccaaatga |
3428817 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University