View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9612A_low_251 (Length: 209)
Name: NF9612A_low_251
Description: NF9612A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9612A_low_251 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 22 - 188
Target Start/End: Original strand, 47094267 - 47094433
Alignment:
| Q |
22 |
agagagggtttggttttgttgttgagtttggttgagttggagaatgtagtagttgtgagtagtaagaagatgatgaacgtgtttgagtggtttgttttgg |
121 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
47094267 |
agagagggtttggttttgttgttgagtttggttgagttggagaatgtagtagttgtgagtagtaagaagatgatgaaagtgtttgagtggtttgttttgg |
47094366 |
T |
 |
| Q |
122 |
gtgccattgttgaatagaggtgagatgagtgatgagaatgtttgttgttcgtttgaaatagttgtta |
188 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||| |
|
|
| T |
47094367 |
gtgccattgttgaatagaggtgagatgagtgatgagaatgttttttgttcatttgaaatagttgtta |
47094433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University