View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9612A_low_252 (Length: 208)
Name: NF9612A_low_252
Description: NF9612A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9612A_low_252 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 76; Significance: 2e-35; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 76; E-Value: 2e-35
Query Start/End: Original strand, 46 - 125
Target Start/End: Complemental strand, 25196202 - 25196123
Alignment:
| Q |
46 |
actgaactagccgtaaaaataaaacctcgtcgggaaagccgccggagttggcctccgtctaccatcagcaacggtgagat |
125 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25196202 |
actgaactggccgtaaaaataaaacctcgtcgggaaagccgccggagttggcctccgtctaccatcagcaacggtgagat |
25196123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University