View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9612A_low_257 (Length: 203)
Name: NF9612A_low_257
Description: NF9612A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9612A_low_257 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 156; Significance: 4e-83; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 156; E-Value: 4e-83
Query Start/End: Original strand, 26 - 189
Target Start/End: Complemental strand, 37809249 - 37809086
Alignment:
| Q |
26 |
ttattcaggtacatggaaccattgatttccagtgtccctgtaatggtagtagaagggaatcatgagatagaagaacaagctgaaaacaagacattcgttg |
125 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37809249 |
ttattcaggtacatggaaccattgatttccagtgtcccggtaatggtagtagaagggaatcatgagatagaagaacaagctgaaaacaagacattcgttg |
37809150 |
T |
|
| Q |
126 |
cttatagttctcgatttgcatttccgtcggaagagagtggatcatcttcaactttatattattc |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
37809149 |
cttatagttctcgatttgcatttccgtcggaagagagtgggtcatcttcaactttatattattc |
37809086 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 28 - 189
Target Start/End: Complemental strand, 37816661 - 37816500
Alignment:
| Q |
28 |
attcaggtacatggaaccattgatttccagtgtccctgtaatggtagtagaagggaatcatgagatagaagaacaagctgaaaacaagacattcgttgct |
127 |
Q |
| |
|
|||||||||||||||||| ||||| | |||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37816661 |
attcaggtacatggaacctctgattgctagtgtcccaataatggtagtggaagggaatcatgagatagaagaacaagctgaaaacaagacattcgttgct |
37816562 |
T |
|
| Q |
128 |
tatagttctcgatttgcatttccgtcggaagagagtggatcatcttcaactttatattattc |
189 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||| || ||||| |||||||| |
|
|
| T |
37816561 |
tatagttctcgatttgcatttccgtcagaagagagtggatcatcatccactttctattattc |
37816500 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University