View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9612A_low_258 (Length: 202)
Name: NF9612A_low_258
Description: NF9612A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9612A_low_258 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 143; Significance: 2e-75; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 143; E-Value: 2e-75
Query Start/End: Original strand, 34 - 184
Target Start/End: Complemental strand, 53617200 - 53617050
Alignment:
| Q |
34 |
catccaattcaatctccggtaacatcgaatccggaacgtgtgcatcttgatacagcgtcaccgatcctcctcgccgaaccggaaaatacgaatcctgaac |
133 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53617200 |
catccaattcaatctccggtaacatcgaatctggaacgtgtgcatcttgatacagcgtcaccgatcctcctcgccgaaccggaaaatacgaatcctgaac |
53617101 |
T |
|
| Q |
134 |
cgcaaacctatcaggaccgggaataacgccggaacgatacataggattttc |
184 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
53617100 |
cgcaaacctatcaggaccgggaataacaccggaacgatacataggattttc |
53617050 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University