View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9612A_low_259 (Length: 202)
Name: NF9612A_low_259
Description: NF9612A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9612A_low_259 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 18 - 177
Target Start/End: Complemental strand, 3006718 - 3006558
Alignment:
| Q |
18 |
aacaacttaatctagtagggctattctgatggtgactagtgtggggataaaattgataggaggagcacaattagttatgtgtttaaggtacaaggagatc |
117 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3006718 |
aacaacttaatctagtaggactattctgatggtgactagtgtggagataaaattgataggaggagcacaattagttatgtgtttaaggtacaaggagatc |
3006619 |
T |
|
| Q |
118 |
gtatctcatggccatataagaagcaattaatggtttc-tttatcaagttatgaagaataat |
177 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
3006618 |
gtatctcatggccatataagaagcaattaatggtttcttttatcaagttatgaagaataat |
3006558 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University