View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9612A_low_30 (Length: 375)
Name: NF9612A_low_30
Description: NF9612A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9612A_low_30 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 117; Significance: 2e-59; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 117; E-Value: 2e-59
Query Start/End: Original strand, 68 - 291
Target Start/End: Complemental strand, 20514366 - 20514148
Alignment:
| Q |
68 |
ggagatttttgctatgtagaagatgacttgttctaacttaaaaggaacaacaaatcattcttgtaaatgtgatgaatcttttgcagtttaactcagattc |
167 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
20514366 |
ggagatttttgctatgtagaagatgatttgttctaacttaaaaggaacaacaaatcattcttgtagatgtgatgaatcttttgcagtttaactcagattc |
20514267 |
T |
|
| Q |
168 |
agtagtttgtttataaattatgcannnnnnnnnnnnnnnnncagatctaagatgtgatggtcgatctgcttcctattttctgtatacttgtgttacttat |
267 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||| | | || |||||||||||||| ||||| |
|
|
| T |
20514266 |
agtagtttgtttataaattatgcattttttgtttggtttttcagatctaagatgtgatggtcgatc-----cattagttatgtatacttgtgttgcttat |
20514172 |
T |
|
| Q |
268 |
cagttacagtttaatccattagtt |
291 |
Q |
| |
|
||||| |||||||||||||||||| |
|
|
| T |
20514171 |
cagttccagtttaatccattagtt |
20514148 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 294 - 366
Target Start/End: Complemental strand, 20514081 - 20514009
Alignment:
| Q |
294 |
agtatatcacaagtattatttttataactagaaaataatttatcgttaattacattcgtctcgttagtataat |
366 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||| |
|
|
| T |
20514081 |
agtatatcacaagtattatttttataactagaaaataatttatcgttaattaccttcgtctcgttaatataat |
20514009 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University