View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9612A_low_39 (Length: 361)
Name: NF9612A_low_39
Description: NF9612A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9612A_low_39 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 59; Significance: 6e-25; HSPs: 7)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 21 - 79
Target Start/End: Complemental strand, 25517358 - 25517300
Alignment:
| Q |
21 |
ataccatcacttgtcttttatgtttaaattgtctaggattgtgacagaatattggtttt |
79 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25517358 |
ataccatcacttgtcttttatgtttaaattgtctaggattgtgacagaatattggtttt |
25517300 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 29 - 79
Target Start/End: Complemental strand, 26048024 - 26047974
Alignment:
| Q |
29 |
acttgtcttttatgtttaaattgtctaggattgtgacagaatattggtttt |
79 |
Q |
| |
|
|||||||||||||| | |||||||||||||||||||||||||||||||||| |
|
|
| T |
26048024 |
acttgtcttttatgataaaattgtctaggattgtgacagaatattggtttt |
26047974 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 29 - 79
Target Start/End: Complemental strand, 26050049 - 26049999
Alignment:
| Q |
29 |
acttgtcttttatgtttaaattgtctaggattgtgacagaatattggtttt |
79 |
Q |
| |
|
|||||||||||||| | |||||||||||||||||||||||||||||||||| |
|
|
| T |
26050049 |
acttgtcttttatgataaaattgtctaggattgtgacagaatattggtttt |
26049999 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 29 - 79
Target Start/End: Complemental strand, 26069193 - 26069143
Alignment:
| Q |
29 |
acttgtcttttatgtttaaattgtctaggattgtgacagaatattggtttt |
79 |
Q |
| |
|
|||||||||||||| | |||||||||||||||||||||||||||||||||| |
|
|
| T |
26069193 |
acttgtcttttatgataaaattgtctaggattgtgacagaatattggtttt |
26069143 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 29 - 79
Target Start/End: Complemental strand, 26071218 - 26071168
Alignment:
| Q |
29 |
acttgtcttttatgtttaaattgtctaggattgtgacagaatattggtttt |
79 |
Q |
| |
|
|||||||||||||| | |||||||||||||||||||||||||||||||||| |
|
|
| T |
26071218 |
acttgtcttttatgataaaattgtctaggattgtgacagaatattggtttt |
26071168 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 28 - 79
Target Start/End: Complemental strand, 25525575 - 25525524
Alignment:
| Q |
28 |
cacttgtcttttatgtttaaattgtctaggattgtgacagaatattggtttt |
79 |
Q |
| |
|
|||||||||||| ||||||||||||||| |||||||||| |||||||||||| |
|
|
| T |
25525575 |
cacttgtcttttctgtttaaattgtctacgattgtgacaaaatattggtttt |
25525524 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 29 - 79
Target Start/End: Complemental strand, 26086305 - 26086255
Alignment:
| Q |
29 |
acttgtcttttatgtttaaattgtctaggattgtgacagaatattggtttt |
79 |
Q |
| |
|
|||||||||||||| | ||||||||||||||||||||||||| |||||||| |
|
|
| T |
26086305 |
acttgtcttttatgataaaattgtctaggattgtgacagaatgttggtttt |
26086255 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University