View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9612A_low_47 (Length: 354)
Name: NF9612A_low_47
Description: NF9612A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9612A_low_47 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 243; Significance: 1e-134; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 243; E-Value: 1e-134
Query Start/End: Original strand, 60 - 310
Target Start/End: Original strand, 46301247 - 46301497
Alignment:
| Q |
60 |
cacattgtaacaaacaccaacctttgcaacagctacatttttgttttctcatacttactctttgtggtttttgtctttctttgtaacaatggaagacgaa |
159 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46301247 |
cacattgtaacaaacaccaacctttgcaacagctacattttagttttctcatacttactctttgtggtttttgtctttctttgtaacaatggaagacgaa |
46301346 |
T |
 |
| Q |
160 |
ggcttaatgcctttgttctatgctaggcagaaaaaatggtggttccatgcgacaacaatgtttctcatgctgttgcttctttctccatttgcattttcac |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46301347 |
ggcttaatgcctttgttctatgctaggcagaaaaaatggtggttccatgcgacaacaatgtttctcatgctgttgcttctttctccatttgcattttcac |
46301446 |
T |
 |
| Q |
260 |
ttcaggaagaaggtttgtgcttttgtaacttttattgtcatgtggagtaac |
310 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
46301447 |
ttcaggaagaaggtttgtgcttttgtaactattattgtcatgtggagtaac |
46301497 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 57 - 87
Target Start/End: Original strand, 46301218 - 46301248
Alignment:
| Q |
57 |
ccccacattgtaacaaacaccaacctttgca |
87 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
46301218 |
ccccacattgtaacaaacaccaacctttgca |
46301248 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University