View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9612A_low_63 (Length: 336)
Name: NF9612A_low_63
Description: NF9612A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9612A_low_63 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 312; Significance: 1e-176; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 312; E-Value: 1e-176
Query Start/End: Original strand, 7 - 330
Target Start/End: Complemental strand, 36170699 - 36170376
Alignment:
| Q |
7 |
atatagcaactgatccacaaaaccataactcattaaaatacttacagagctagatgaagaaaaacacaaactttcaatagccctcattgttatttccttt |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36170699 |
atatagcaactgatccacaaaaccataactcattaaaatacttacagagctagatgaagtaaaacacaaactttcaatagccctcattgttatttccttt |
36170600 |
T |
|
| Q |
107 |
gtttttgaagaatatgaccatttcggatctaaaacacgtaacaaagcacggattccgccttctctaatcaccgtttgcctaaccaactcatctccaaagg |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
36170599 |
gtttttgaagaatatgaccatttcggatctaaaacacgtaacaaagcacggattccgccttctctaatcaccatttgcctaaccaactcatctccaaagg |
36170500 |
T |
|
| Q |
207 |
caatattctgaatgaaccctattgaattcacctgaattgcttcctcctttgatttcactagcctgataaaagtcgacaccgcatcctcctcaaccataaa |
306 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
36170499 |
caatattctgaatgaaccctattgaattcacctgaattgcttcctcctttgatttcactagcctgataaaagtcgacaccgcatcctcctcaaccatgaa |
36170400 |
T |
|
| Q |
307 |
tctcttaacttcctcaacaccaac |
330 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
36170399 |
tctcttaacttcctcaacaccaac |
36170376 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 7 - 58
Target Start/End: Original strand, 1286343 - 1286394
Alignment:
| Q |
7 |
atatagcaactgatccacaaaaccataactcattaaaatacttacagagcta |
58 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1286343 |
atatagcaactgatccacaaaaccataactcattaaaatacttacagagcta |
1286394 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University