View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9612A_low_67 (Length: 332)
Name: NF9612A_low_67
Description: NF9612A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9612A_low_67 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 143; Significance: 4e-75; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 143; E-Value: 4e-75
Query Start/End: Original strand, 14 - 164
Target Start/End: Complemental strand, 35426508 - 35426358
Alignment:
| Q |
14 |
tatgaaccacttctagatgattatcaataatatttcttttctgctatgaactacttctagatccttattaataatatttcttttgtgtgtttatgagttt |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
35426508 |
tatgaaccacttctagatgattatcaataatatttcttttctgctatgaactacttctagatccttattaataatatttcttttgtgtgtttatgaattt |
35426409 |
T |
|
| Q |
114 |
gttttaatttgtttgatgtacgatgtatggcaaaagtttggaagagtttaa |
164 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35426408 |
gtgttaatttgtttgatgtacgatgtatggcaaaagtttggaagagtttaa |
35426358 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 224 - 326
Target Start/End: Complemental strand, 35426353 - 35426245
Alignment:
| Q |
224 |
tttcttcaaaatcaaatctaatgagatgagattacacccaa------tcatcaaatccttttaagaattcccccaatcnnnnnnncattaattttgaaat |
317 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
35426353 |
tttcttcaaaatcaaatctaatgagatgagattacacccaaacccaatcatcaaatccttttaagaattcccccaatcaaaaaagcattaattttgaaat |
35426254 |
T |
|
| Q |
318 |
acactgtat |
326 |
Q |
| |
|
||||||||| |
|
|
| T |
35426253 |
acactgtat |
35426245 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 52 - 97
Target Start/End: Complemental strand, 35426514 - 35426469
Alignment:
| Q |
52 |
ttctgctatgaactacttctagatccttattaataatatttctttt |
97 |
Q |
| |
|
||||||||||||| |||||||||| |||| ||||||||||||||| |
|
|
| T |
35426514 |
ttctgctatgaaccacttctagatgattatcaataatatttctttt |
35426469 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University