View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9612A_low_69 (Length: 327)
Name: NF9612A_low_69
Description: NF9612A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9612A_low_69 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 109; Significance: 8e-55; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 109; E-Value: 8e-55
Query Start/End: Original strand, 98 - 210
Target Start/End: Original strand, 38313726 - 38313838
Alignment:
| Q |
98 |
aatattcatatgataaaatatgattagatacatgtaaaaaaggtatacaccaacagtatatgtaacttaaatctataagttagattgtaggttgagttaa |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38313726 |
aatattcatatgataaaatatgattagatacatgtaaaaaaggtatacaccaacagtacatgtaacttaaatctataagttagattgtaggttgagttaa |
38313825 |
T |
 |
| Q |
198 |
aaatgcaaaatat |
210 |
Q |
| |
|
||||||||||||| |
|
|
| T |
38313826 |
aaatgcaaaatat |
38313838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University