View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9612A_low_70 (Length: 322)
Name: NF9612A_low_70
Description: NF9612A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9612A_low_70 |
 |  |
|
| [»] chr8 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 123; Significance: 4e-63; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 123; E-Value: 4e-63
Query Start/End: Original strand, 169 - 322
Target Start/End: Original strand, 11213665 - 11213812
Alignment:
| Q |
169 |
cagaatttgactgctttggagagtggtggtggaggtgggtatgggaatgtgttgtatgttagggttcctggtaacgtatccgaggggaagattaaggggt |
268 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
11213665 |
cagaatttgactgctttggagagtgg------aggtgggaatgggaatgtgttgtatgttagggttcctggtaatgtatccgaggggaagattaaggggt |
11213758 |
T |
 |
| Q |
269 |
ggaatggtaaggttttgagtggtgttgttattggatgtgttttgtttttggttt |
322 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11213759 |
ggaatggtaaggttttgagtggtgttgttattggatgtgttttgtttttggttt |
11213812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 89; E-Value: 7e-43
Query Start/End: Original strand, 7 - 107
Target Start/End: Original strand, 11213503 - 11213603
Alignment:
| Q |
7 |
tttggtgttgtaaggtttggttttgagaatgtgagtagttttaaggctaaatctaggagtttgtgtgagcaaggttgtttgaattcttgtgattgtgttg |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
11213503 |
tttggtgttgtaaggtttggttttgagaatgtgagtagtttcagggctaaatctaggagtttgtgtgagcgaggttgtttgaattcttgtgattgtgttg |
11213602 |
T |
 |
| Q |
107 |
g |
107 |
Q |
| |
|
| |
|
|
| T |
11213603 |
g |
11213603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University