View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9612A_low_74 (Length: 310)
Name: NF9612A_low_74
Description: NF9612A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9612A_low_74 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 295; Significance: 1e-166; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 295; E-Value: 1e-166
Query Start/End: Original strand, 4 - 302
Target Start/End: Complemental strand, 33948214 - 33947916
Alignment:
| Q |
4 |
ggagtaggtggtgcaactggtagaacaacctccatgcttgtttgtggaaccaaattccaaaccaaacagttgctatggtggaaatggaaaatgggtgtcg |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33948214 |
ggagtaggtggtgcaactggtagaacaacctccatgtttgtttgtggaaccaaattccaaaccaaacagttgctatggtggaaatggaaaatgggtgtcg |
33948115 |
T |
|
| Q |
104 |
gttggaatgtgaaggggtgattatatagagaagggaagtggggaaggatagaggaaagaggggggtatgagtgggaaagattgacttttgagtgaaggac |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33948114 |
gttggaatgtgaaggggtgattatatagagaagggaagtggggaaggatagaggaaagaggggggtatgagtgggaaagattgacttttgagtgaaggac |
33948015 |
T |
|
| Q |
204 |
tagactggtttttagaaggagcagcctttactagactaccaattgttttccttgctatcattaattatagtattttcttgggtcaatggtgtgtgtgag |
302 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33948014 |
tagactggtttttagaaggagcagcctttactagactaccaattgttttccttgctatcattaattatagtattttcttgggtcaatggtgtgtgtgag |
33947916 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University