View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9612A_low_77 (Length: 307)
Name: NF9612A_low_77
Description: NF9612A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9612A_low_77 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 271; Significance: 1e-151; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 271; E-Value: 1e-151
Query Start/End: Original strand, 1 - 295
Target Start/End: Complemental strand, 38313749 - 38313455
Alignment:
| Q |
1 |
atcatattttatcatatgaatatttttggagatatgtcatgaaataacctgaaaaagtagtatcatacatgatttggtttggatacaagtatagaaattt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
38313749 |
atcatattttatcatatgaatatttttggagatatgtcatgaaataacctgaaaaagtagtatcatacatgatttggtttggatataagtatagaaattt |
38313650 |
T |
 |
| Q |
101 |
tttacactcttaacattgaaattaaatctcttgatttattctattttcataactcttattaaaatttcaaatttggcataagtatacaagtatgtcgaag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
38313649 |
tttacactcttaacattgaaattaaatctcttgatttattctattttcataattcttattaaaatttcaaatttggcataagtatacaagtatgtcaaag |
38313550 |
T |
 |
| Q |
201 |
ggtttgttctgttactactttttattttgttatcggctttgtttagatgaatgctactgctttgtttgctttctatccagtcccatgcgtatatt |
295 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||| |
|
|
| T |
38313549 |
ggtttgttctgttactattttttattttgttatcggctttgtttagatgaatgctactgctttgtttgctttctatccagccccatgtgtatatt |
38313455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University