View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9612A_low_78 (Length: 307)
Name: NF9612A_low_78
Description: NF9612A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9612A_low_78 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 290; Significance: 1e-163; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 290; E-Value: 1e-163
Query Start/End: Original strand, 1 - 302
Target Start/End: Complemental strand, 42548096 - 42547795
Alignment:
| Q |
1 |
agtggagaaacacagatcaagaaacagaacaacttgttcttgacctggaaaacgaggttttaactagtttggttaacgagatcatccttgatctcgttaa |
100 |
Q |
| |
|
|||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42548096 |
agtggaaaaacactgatcaagaaacagaacaacttgttcttgacctggaaaacgaggttttaactagtttggttaacgagatcatccttgatctcgttaa |
42547997 |
T |
|
| Q |
101 |
ataggctagatagtcatggatatgatatgttgcaagtacatttgcttcttatgttttgtattttatgaactttactttctgtctcgttccctgtctcggg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42547996 |
ataggctagatagtcatggatatgatatgttgcaagtacatttgcttcttatgttttgtattttatgaactttactttctgtctcgttccctgtctcggg |
42547897 |
T |
|
| Q |
201 |
gaaacagacagataaattttgaaacaatttaggatatctatgtttagatttggttctaatggttttcttcaacacatctttagtgctttggttggatagg |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
42547896 |
gaaacagacagataaattttgaaacaatttaggatatctatgtttagatttggttctaatggttttcttcaacacatctttagtgctttggttagatagg |
42547797 |
T |
|
| Q |
301 |
gt |
302 |
Q |
| |
|
|| |
|
|
| T |
42547796 |
gt |
42547795 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University