View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9612_low_30 (Length: 390)
Name: NF9612_low_30
Description: NF9612
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9612_low_30 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 314; Significance: 1e-177; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 314; E-Value: 1e-177
Query Start/End: Original strand, 13 - 373
Target Start/End: Original strand, 7413774 - 7414135
Alignment:
| Q |
13 |
atggacatcaaatgttttcatgaggcaaagaagttgtatacctcaagtttcaagactacttaccgttcatggtttgtggccttcaaacatagtgtggcct |
112 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7413774 |
atggacaccaaatgttttcatgaggcaaagaagttgtatacctcaagtttcgagactacttaccgttcatggtttgtggccttcaaacatagtgtggcct |
7413873 |
T |
 |
| Q |
113 |
caacccccaggtttcacatttgtgcaatatgttttcaaatatgtgagtttatttaaattctccttttatgactttctgttgtcatgatgg-tagaatatg |
211 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||| ||||||||| |
|
|
| T |
7413874 |
caacccccacgtttcacatttgtgcaatatgttttcaaatatgtgagtttatttaaattctcattttatgactttctgttgtcatcatggttagaatatg |
7413973 |
T |
 |
| Q |
212 |
gctttttattgcattccttttactagatttatagtttgaagtcagatcttagtacttcttggccagatgttggtggcacttatgatagtttctgtcagag |
311 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
7413974 |
actttttattgcattccttttactagatttatagtttgaagtgagatcttagtacttcttggccagatgttggtggcacttgtgatagtttctgtcagag |
7414073 |
T |
 |
| Q |
312 |
accatgggaaaagcatggaatttgcacaccattcagccagtatgattactttcgccacacct |
373 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||| |
|
|
| T |
7414074 |
accatgggaaaagcatggaatttgcacaccattcagccagtatgattacttttgtcacacct |
7414135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University