View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9612_low_48 (Length: 306)
Name: NF9612_low_48
Description: NF9612
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9612_low_48 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 260; Significance: 1e-145; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 260; E-Value: 1e-145
Query Start/End: Original strand, 1 - 289
Target Start/End: Complemental strand, 14414509 - 14414221
Alignment:
| Q |
1 |
gcattttcagttaacgaaggaatgttcctttccggattacctcgtacagctccccttggaggccgtagagatgcgctctattccctagcatctattgcgg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
14414509 |
gcattttcagttaacgaaggaatgttcctttccggattacctcgtacagctccccttggaggccgtagagatgcgctctattccctagcatctatcgcgg |
14414410 |
T |
 |
| Q |
101 |
aagacgacaaccttccaatgcctaattggccgatggaaaaaatggttgacctctttacnnnnnnnggtttcacaattgaagaaatggttattttacttgg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||| |
|
|
| T |
14414409 |
aagacgacaaccttccaatgcctaattggccgatggaaaaaatggttgacctcttcacaaaaaaaggtttcacaattgaagaaatggttattttacttgg |
14414310 |
T |
 |
| Q |
201 |
tgcgcattcaattggtgtggctcattgcgatgtttttatggaaaggatttacaattacgcagacacgaggaaacctgatcctttgcttc |
289 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14414309 |
tgcgcattcaattggtgtggctcattgcgatgtttttatggaaaggatttacaattacgcagacacgaggaaacctgatcctttgcttc |
14414221 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University